Regulon of YtrA in Lactobacillus brevis ATCC 367

Properties
Regulator type:	Transcription factor
TF locus tag:	LVIS_0408
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	YtrA - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 6.7 Sequence: GTGTACTAGGTATAATAGTACAG Locus tag: LVIS_0408 Name: ytrA Funciton: Predicted transcriptional regulator, GntR family Locus tag: LVIS_0409 Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: LVIS_0410 Name: lp_0327 Funciton: Predicted ABC transporter, permease protein
	LVIS_0408	ytrA	Predicted transcriptional regulator, GntR family
	LVIS_0409	ytrB	Predicted ABC transporter, ATP-binding protein
	LVIS_0410	lp_0327	Predicted ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD