Regulon of YtrA in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type:	Transcription factor
TF locus tag:	LEUM_0050
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	YtrA - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -123 Score: 6.6 Sequence: GTGTACTGTGTATTATAGTACAC Locus tag: LEUM_0050 Name: ytrA Funciton: Predicted transcriptional regulator, GntR family Locus tag: LEUM_0051 Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: LEUM_0052 Name: LEUM_0052 Funciton: Hypothetical protein Locus tag: LEUM_0053 Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: LEUM_0054 Name: OEOE_1804 Funciton: Predicted ABC transporter, permease protein
	LEUM_0050	ytrA	Predicted transcriptional regulator, GntR family
	LEUM_0051	ytrB	Predicted ABC transporter, ATP-binding protein
	LEUM_0052	LEUM_0052	Hypothetical protein
	LEUM_0053	ytrB	Predicted ABC transporter, ATP-binding protein
	LEUM_0054	OEOE_1804	Predicted ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD