Regulog LACR_0766 - Streptococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11	6	1
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124	5	2
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
LACR_0761	* Lactococcus lactis subsp. cremoris SK11 Site: position = -35 score = 6.31715 sequence = AGAGTTTAACGTTAAACTAA Gene: LACR_0761: Predicted polysaccharide ABC transporter, permease protein 1	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -121 score = 6.25168 sequence = TCGGTTTAACGATAAACTAA Gene: SDEG_1903: Predicted polysaccharide ABC transporter, permease protein 1	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted polysaccharide ABC transporter, permease protein 1
LACR_0762	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0762: Predicted polysaccharide ABC transporter, permease protein 2	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1902: Predicted polysaccharide ABC transporter, permease protein 2	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted polysaccharide ABC transporter, permease protein 2
LACR_0763	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0763: Predicted polysaccharide ABC transporter, substrate-binding protein	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1900: Predicted polysaccharide ABC transporter, substrate-binding protein	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted polysaccharide ABC transporter, substrate-binding protein
LACR_0764	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0764: Predicted integral membrane protein	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1901: Predicted integral membrane protein	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted integral membrane protein
LACR_0765	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0765: Predicted maltodextrin glucosidase (EC 3.2.1.20)	Lactococcus lactis subsp. lactis Il1403 Gene: L129481: Predicted maltodextrin glucosidase (EC 3.2.1.20)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159 Gene: SMU.104: Predicted maltodextrin glucosidase (EC 3.2.1.20)	Streptococcus pneumoniae TIGR4 Gene: SP_0312: Predicted maltodextrin glucosidase (EC 3.2.1.20)	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted maltodextrin glucosidase (EC 3.2.1.20)
LACR_0766	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0766: Predicted sugar utilization transcriptional regulator, LacI family	Lactococcus lactis subsp. lactis Il1403 Gene: L0147: Predicted sugar utilization transcriptional regulator, LacI family	Streptococcus agalactiae 2603V/R	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -232 score = 5.83406 sequence = TAGGTTTATCGTTAAACTAT Gene: SDEG_1904: Predicted sugar utilization transcriptional regulator, LacI family	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Predicted sugar utilization transcriptional regulator, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog LACR_0766 - Streptococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --