Regulog LACR_0766 - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | 6 | 1 |
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | 5 | 2 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||
| Streptococcus gallolyticus UCN34 | ||
| Streptococcus gordonii str. Challis substr. CH1 | ||
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | ||
| Streptococcus pneumoniae TIGR4 | ||
| Streptococcus pyogenes M1 GAS | ||
| Streptococcus sanguinis SK36 | ||
| Streptococcus suis 05ZYH33 | ||
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| LACR_0761 |
*
Lactococcus lactis subsp. cremoris SK11 Site: position = -35 score = 6.31715 sequence = AGAGTTTAACGTTAAACTAA Gene: LACR_0761: Predicted polysaccharide ABC transporter, permease protein 1 |
|
|
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -121 score = 6.25168 sequence = TCGGTTTAACGATAAACTAA Gene: SDEG_1903: Predicted polysaccharide ABC transporter, permease protein 1 |
|
|
|
|
|
|
|
|
|
|
|
Predicted polysaccharide ABC transporter, permease protein 1 |
| LACR_0762 |
Gene: LACR_0762: Predicted polysaccharide ABC transporter, permease protein 2 |
|
|
Gene: SDEG_1902: Predicted polysaccharide ABC transporter, permease protein 2 |
|
|
|
|
|
|
|
|
|
|
|
Predicted polysaccharide ABC transporter, permease protein 2 |
| LACR_0763 |
Gene: LACR_0763: Predicted polysaccharide ABC transporter, substrate-binding protein |
|
|
Gene: SDEG_1900: Predicted polysaccharide ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
|
Predicted polysaccharide ABC transporter, substrate-binding protein |
| LACR_0764 |
Gene: LACR_0764: Predicted integral membrane protein |
|
|
Gene: SDEG_1901: Predicted integral membrane protein |
|
|
|
|
|
|
|
|
|
|
|
Predicted integral membrane protein |
| LACR_0765 |
Gene: LACR_0765: Predicted maltodextrin glucosidase (EC 3.2.1.20) |
Gene: L129481: Predicted maltodextrin glucosidase (EC 3.2.1.20) |
|
|
|
|
|
|
Gene: SMU.104: Predicted maltodextrin glucosidase (EC 3.2.1.20) |
Gene: SP_0312: Predicted maltodextrin glucosidase (EC 3.2.1.20) |
|
|
|
|
|
Predicted maltodextrin glucosidase (EC 3.2.1.20) |
| LACR_0766 |
Gene: LACR_0766: Predicted sugar utilization transcriptional regulator, LacI family |
Gene: L0147: Predicted sugar utilization transcriptional regulator, LacI family |
|
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -232 score = 5.83406 sequence = TAGGTTTATCGTTAAACTAT Gene: SDEG_1904: Predicted sugar utilization transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
|
|
|
Predicted sugar utilization transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |