Regulon of LACR_0766 in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type:	Transcription factor
TF locus tag:	SDEG_1904
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	LACR_0766 - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -232 Score: 5.8 Sequence: TAGGTTTATCGTTAAACTAT Locus tag: SDEG_1904 Name: LACR_0766 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	SDEG_1904	LACR_0766	Predicted sugar utilization transcriptional regulator, LacI family
Position: -121 Score: 6.3 Sequence: TCGGTTTAACGATAAACTAA Locus tag: SDEG_1903 Name: LACR_0761 Funciton: Predicted polysaccharide ABC transporter, permease protein 1 Locus tag: SDEG_1902 Name: LACR_0762 Funciton: Predicted polysaccharide ABC transporter, permease protein 2 Locus tag: SDEG_1901 Name: LACR_0764 Funciton: Predicted integral membrane protein Locus tag: SDEG_1900 Name: LACR_0763 Funciton: Predicted polysaccharide ABC transporter, substrate-binding protein
	SDEG_1903	LACR_0761	Predicted polysaccharide ABC transporter, permease protein 1
	SDEG_1902	LACR_0762	Predicted polysaccharide ABC transporter, permease protein 2
	SDEG_1901	LACR_0764	Predicted integral membrane protein
	SDEG_1900	LACR_0763	Predicted polysaccharide ABC transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD