Regulon of LACR_0766 in Lactococcus lactis subsp. cremoris SK11

Properties
Regulator type:	Transcription factor
TF locus tag:	LACR_0766
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	LACR_0766 - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6.3 Sequence: AGAGTTTAACGTTAAACTAA Locus tag: LACR_0761 Name: LACR_0761 Funciton: Predicted polysaccharide ABC transporter, permease protein 1 Locus tag: LACR_0762 Name: LACR_0762 Funciton: Predicted polysaccharide ABC transporter, permease protein 2 Locus tag: LACR_0763 Name: LACR_0763 Funciton: Predicted polysaccharide ABC transporter, substrate-binding protein Locus tag: LACR_0764 Name: LACR_0764 Funciton: Predicted integral membrane protein Locus tag: LACR_0765 Name: LACR_0765 Funciton: Predicted maltodextrin glucosidase (EC 3.2.1.20) Locus tag: LACR_0766 Name: LACR_0766 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	LACR_0761	LACR_0761	Predicted polysaccharide ABC transporter, permease protein 1
	LACR_0762	LACR_0762	Predicted polysaccharide ABC transporter, permease protein 2
	LACR_0763	LACR_0763	Predicted polysaccharide ABC transporter, substrate-binding protein
	LACR_0764	LACR_0764	Predicted integral membrane protein
	LACR_0765	LACR_0765	Predicted maltodextrin glucosidase (EC 3.2.1.20)
	LACR_0766	LACR_0766	Predicted sugar utilization transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD