Regulog MalR3 - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltose utilization
- By pathway - Maltodextrin utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 3 | 2 |
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | 3 | 2 |
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 7 | 4 |
| Lactobacillus reuteri JCM 1112 | 4 | 2 |
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | 4 | 3 |
| Oenococcus oeni PSU-1 | 3 | 2 |
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| nplT |
Gene: LBA1871: Neopullulanase (EC 3.2.1.135) |
Gene: LVIS_2180: Neopullulanase (EC 3.2.1.135) |
Gene: LSEI_0980: Neopullulanase (EC 3.2.1.135) |
|
*
Lactobacillus fermentum IFO 3956 Site: position = -56 score = 6.03015 sequence = TTACTCAAACGTTTGCGTAA Gene: LAF_0739: Neopullulanase (EC 3.2.1.135) |
Gene: lhv_2001: Neopullulanase (EC 3.2.1.135) |
Gene: LJ0212: Neopullulanase (EC 3.2.1.135) |
*3
Lactobacillus plantarum WCFS1 Site: position = -34 score = 5.4801 sequence = TAATGTAATCGTTTACATAA Gene: lp_2757: Neopullulanase (EC 3.2.1.135) Gene: lp_0193: Neopullulanase (EC 3.2.1.135) Site: position = -52 score = 6.31272 sequence = TTAAGCAAACGTTTGCTTAA Gene: lp_3627: Neopullulanase (EC 3.2.1.135) |
*2
Lactobacillus reuteri JCM 1112 Gene: LAR_1507: Neopullulanase (EC 3.2.1.135) Site: position = -69 score = 6.07009 sequence = TTAAGTAAACGTTTACATTA Gene: LAR_0078: Neopullulanase (EC 3.2.1.135) |
Gene: LGG_00944: Neopullulanase (EC 3.2.1.135) |
|
Gene: LSL_1295: Neopullulanase (EC 3.2.1.135) |
*2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0899: Neopullulanase (EC 3.2.1.135) Site: position = -94 score = 5.07643 sequence = CTAAGTAAACGTTTACTGTA Gene: LEUM_0828: Neopullulanase (EC 3.2.1.135) |
Gene: OEOE_0040: Neopullulanase (EC 3.2.1.135) |
|
Neopullulanase (EC 3.2.1.135) |
| malT2 |
|
*
Lactobacillus brevis ATCC 367 Site: position = -106 score = 5.4864 sequence = TTACACAAACGTTTGCTTTT Gene: LVIS_2179: Predicted maltose/maltodextrin permease |
|
|
Gene: LAF_0738: Predicted maltose/maltodextrin permease |
|
|
*2
Lactobacillus plantarum WCFS1 Gene: lp_3626: Predicted maltose/maltodextrin permease Site: position = -106 score = 5.5097 sequence = AAGTGTAAACGTTTACTTTA Site: position = -74 score = 5.778 sequence = TATTGTAAACGTTTACGTTA Gene: lp_3533: Predicted maltose/maltodextrin permease |
*2
Lactobacillus reuteri JCM 1112 Site: position = -115 score = 5.01811 sequence = AAAAGTAAACGGTTGCTAAT Gene: LAR_1508: Predicted maltose/maltodextrin permease Gene: LAR_0079: Predicted maltose/maltodextrin permease |
|
|
|
2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0898: Predicted maltose/maltodextrin permease Gene: LEUM_0827: Predicted maltose/maltodextrin permease |
*
Oenococcus oeni PSU-1 Site: position = -59 score = 6.14554 sequence = TTTTGTAAACGTTTACTTAA Gene: OEOE_0041: Predicted maltose/maltodextrin permease |
|
Predicted maltose/maltodextrin permease |
| malR3 |
|
*
Lactobacillus brevis ATCC 367 Site: position = -108 score = 5.4864 sequence = AAAAGCAAACGTTTGTGTAA Gene: LVIS_2178: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family |
|
|
*
Lactobacillus fermentum IFO 3956 Site: position = -121 score = 6.03015 sequence = TTACGCAAACGTTTGAGTAA Gene: LAF_0740: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family |
|
|
*2
Lactobacillus plantarum WCFS1 Gene: lp_3625: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family Site: position = -115 score = 5.778 sequence = TAACGTAAACGTTTACAATA Site: position = -83 score = 5.5097 sequence = TAAAGTAAACGTTTACACTT Gene: lp_3531: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family |
Gene: LAR_0083: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family |
|
|
|
*2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -78 score = 6.21664 sequence = TTGAGTAAACGTTTACGCAA Gene: LEUM_0896: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family Site: position = -135 score = 5.07643 sequence = TACAGTAAACGTTTACTTAG Gene: LEUM_0829: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family |
*
Oenococcus oeni PSU-1 Site: position = -149 score = 6.14554 sequence = TTAAGTAAACGTTTACAAAA Gene: OEOE_0042: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family |
|
Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family |
| agl |
Gene: LBA1812: Alpha-glucosidase (EC 3.2.1.20) |
|
|
|
|
|
Gene: LJ0569: Alpha-glucosidase (EC 3.2.1.20) |
Gene: lp_3534: Alpha-glucosidase (EC 3.2.1.20) |
Gene: LAR_0972: Alpha-glucosidase (EC 3.2.1.20) |
|
|
|
|
|
|
Alpha-glucosidase (EC 3.2.1.20) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |