Regulon of MalR3 in Lactobacillus reuteri JCM 1112

Properties
Regulator type:	Transcription factor
TF locus tag:	LAR_0083
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR3 - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -115 Score: 5 Sequence: AAAAGTAAACGGTTGCTAAT Locus tag: LAR_1508 Name: malT2 Funciton: Predicted maltose/maltodextrin permease Locus tag: LAR_1507 Name: nplT Funciton: Neopullulanase (EC 3.2.1.135)
	LAR_1508	malT2	Predicted maltose/maltodextrin permease
	LAR_1507	nplT	Neopullulanase (EC 3.2.1.135)
Position: -69 Score: 6.1 Sequence: TTAAGTAAACGTTTACATTA Locus tag: LAR_0078 Name: nplT Funciton: Neopullulanase (EC 3.2.1.135) Locus tag: LAR_0079 Name: malT2 Funciton: Predicted maltose/maltodextrin permease
	LAR_0078	nplT	Neopullulanase (EC 3.2.1.135)
	LAR_0079	malT2	Predicted maltose/maltodextrin permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD