Regulon of MalR3 in Lactobacillus fermentum IFO 3956

Properties
Regulator type:	Transcription factor
TF locus tag:	LAF_0740
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR3 - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 6 Sequence: TTACGCAAACGTTTGAGTAA Locus tag: LAF_0740 Name: malR3 Funciton: Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
	LAF_0740	malR3	Predicted maltodextrin utilization transcriptional regulator MalR3, LacI family
Position: -56 Score: 6 Sequence: TTACTCAAACGTTTGCGTAA Locus tag: LAF_0739 Name: nplT Funciton: Neopullulanase (EC 3.2.1.135) Locus tag: LAF_0738 Name: malT2 Funciton: Predicted maltose/maltodextrin permease
	LAF_0739	nplT	Neopullulanase (EC 3.2.1.135)
	LAF_0738	malT2	Predicted maltose/maltodextrin permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD