Regulog MdxR - Lactobacillaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	activator
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Statistics of regulated genes
Genome	Genes	Operons
Lactobacillus acidophilus NCFM	4	2
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334	3	2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571	2	1
Lactobacillus johnsonii NCC 533	4	2
Lactobacillus plantarum WCFS1	5	2
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	7	2
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
malX	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	* Lactobacillus plantarum WCFS1 Site: position = -103 score = 6.32785 sequence = TTCTGTTAACGTTAACATTA Gene: lp_0175: Maltose/maltodextrin ABC transporter, substrate-binding protein	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Maltose/maltodextrin ABC transporter, substrate-binding protein
malC	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_0176: Maltose/maltodextrin ABC transporter, permease protein 1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Maltose/maltodextrin ABC transporter, permease protein 1
malD	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_0177: Maltose/maltodextrin ABC transporter, permease protein 2	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Maltose/maltodextrin ABC transporter, permease protein 2
malA	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_0178: Maltodextrose utilization protein MalA	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Maltodextrose utilization protein MalA

CRON 2.
malT	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367 Gene: LVIS_0357: Predicted maltose/maltodextrin permease	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956 Gene: LAF_0024: Predicted maltose/maltodextrin permease	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_1729: Predicted maltose/maltodextrin permease	Lactobacillus reuteri JCM 1112 Gene: LAR_0051: Predicted maltose/maltodextrin permease	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_1282: Predicted maltose/maltodextrin permease	2 Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293* Site: position = -104 score = 6.10104 sequence = TGATGTTACCGTTAACATCG Gene: LEUM_0893: Predicted maltose/maltodextrin permease Site: position = -203 score = 6.30368 sequence = TAATGTTATCGTTAACATTG Gene: LEUM_0994: Predicted maltose/maltodextrin permease	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0968: Predicted maltose/maltodextrin permease	Predicted maltose/maltodextrin permease
malK	* Lactobacillus acidophilus NCFM Site: position = -104 score = 5.7234 sequence = TTCTGATACCGGTAACATGG Gene: LBA1870: Maltose phosphorylase (EC 2.4.1.8)	Lactobacillus brevis ATCC 367 Gene: LVIS_0358: Maltose phosphorylase (EC 2.4.1.8)	* Lactobacillus casei ATCC 334 Site: position = -129 score = 5.77663 sequence = TTATGATAGCGGTAACATTC Gene: LSEI_0982: Maltose phosphorylase (EC 2.4.1.8)	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956 Gene: LAF_0025: Maltose phosphorylase (EC 2.4.1.8)	Lactobacillus helveticus DPC 4571 Gene: lhv_2000: Maltose phosphorylase (EC 2.4.1.8)	* Lactobacillus johnsonii NCC 533 Site: position = -100 score = 6.13006 sequence = TTTTGATACCGGTAACATTA Gene: LJ0213: Maltose phosphorylase (EC 2.4.1.8)	Lactobacillus plantarum WCFS1 Gene: lp_1730: Maltose phosphorylase (EC 2.4.1.8)	Lactobacillus reuteri JCM 1112 Gene: LAR_0052: Maltose phosphorylase (EC 2.4.1.8)	Lactobacillus rhamnosus GG Gene: LGG_00945: Maltose phosphorylase (EC 2.4.1.8)	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_1280: Maltose phosphorylase (EC 2.4.1.8)	2 Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0894: Maltose phosphorylase (EC 2.4.1.8) Gene: LEUM_0995: Maltose phosphorylase (EC 2.4.1.8)	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0967: Maltose phosphorylase (EC 2.4.1.8)	Maltose phosphorylase (EC 2.4.1.8)
galM	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_1731: Aldose 1-epimerase	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_1281: Aldose 1-epimerase	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0996: Aldose 1-epimerase	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Aldose 1-epimerase
pgcM	Lactobacillus acidophilus NCFM Gene: LBA1869: Beta-phosphoglucomutase (EC 5.4.2.6)	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334 Gene: LSEI_0983: Beta-phosphoglucomutase (EC 5.4.2.6)	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956 Gene: LAF_0026: Beta-phosphoglucomutase (EC 5.4.2.6)	Lactobacillus helveticus DPC 4571 Gene: lhv_1999: Beta-phosphoglucomutase (EC 5.4.2.6)	Lactobacillus johnsonii NCC 533 Gene: LJ0214: Beta-phosphoglucomutase (EC 5.4.2.6)	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112 Gene: LAR_0053: Beta-phosphoglucomutase (EC 5.4.2.6)	Lactobacillus rhamnosus GG Gene: LGG_00946: Beta-phosphoglucomutase (EC 5.4.2.6)	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_1279: Beta-phosphoglucomutase (EC 5.4.2.6)	2 Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0895: Beta-phosphoglucomutase (EC 5.4.2.6) Gene: LEUM_0997: Beta-phosphoglucomutase (EC 5.4.2.6)	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_0966: Beta-phosphoglucomutase (EC 5.4.2.6)	Beta-phosphoglucomutase (EC 5.4.2.6)

CRON 3.
malL	* Lactobacillus acidophilus NCFM Site: position = -78 score = 5.36757 sequence = TTTTGATACCGCTAACATCT Gene: LBA1872: Oligo-1,6-glucosidase (EC 3.2.1.10)	Lactobacillus brevis ATCC 367 Gene: LVIS_0309: Oligo-1,6-glucosidase (EC 3.2.1.10)	* Lactobacillus casei ATCC 334 Site: position = -82 score = 5.39035 sequence = TTTTGATAACGGTAACAAAC Gene: LSEI_0980: Oligo-1,6-glucosidase (EC 3.2.1.10)	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	* Lactobacillus helveticus DPC 4571 Site: position = -63 score = 5.5702 sequence = TTTTGATACCGGTAACATCC Gene: lhv_2002: Oligo-1,6-glucosidase (EC 3.2.1.10)	* Lactobacillus johnsonii NCC 533 Site: position = -81 score = 5.50873 sequence = TTTTGATACCGGTAACAGAT Gene: LJ0211: Oligo-1,6-glucosidase (EC 3.2.1.10)	Lactobacillus plantarum WCFS1 Gene: lp_0174: Oligo-1,6-glucosidase (EC 3.2.1.10)	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Oligo-1,6-glucosidase (EC 3.2.1.10)
nplT	Lactobacillus acidophilus NCFM Gene: LBA1871: Neopullulanase (EC 3.2.1.135)	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571 Gene: lhv_2001: Neopullulanase (EC 3.2.1.135)	Lactobacillus johnsonii NCC 533 Gene: LJ0212: Neopullulanase (EC 3.2.1.135)	* Lactobacillus plantarum WCFS1 Site: position = -34 score = 5.79805 sequence = TAATGTAATCGTTTACATAA Gene: lp_2757: Neopullulanase (EC 3.2.1.135)	Lactobacillus reuteri JCM 1112 Gene: LAR_1507: Neopullulanase (EC 3.2.1.135)	Lactobacillus rhamnosus GG Gene: LGG_00944: Neopullulanase (EC 3.2.1.135)	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_0067: Neopullulanase (EC 3.2.1.135)	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Neopullulanase (EC 3.2.1.135)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MdxR - Lactobacillaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --