Regulon of MdxR in Lactobacillus plantarum WCFS1

Properties
Regulator type:	Transcription factor
TF locus tag:	lp_0173
Regulator family:	LacI
Regulation mode:	activator
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MdxR - Lactobacillaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 5.8 Sequence: TAATGTAATCGTTTACATAA Locus tag: lp_2757 Name: nplT Funciton: Neopullulanase (EC 3.2.1.135)
	lp_2757	nplT	Neopullulanase (EC 3.2.1.135)
Position: -103 Score: 6.3 Sequence: TTCTGTTAACGTTAACATTA Locus tag: lp_0175 Name: malX Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: lp_0176 Name: malC Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: lp_0177 Name: malD Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: lp_0178 Name: malA Funciton: Maltodextrose utilization protein MalA
	lp_0175	malX	Maltose/maltodextrin ABC transporter, substrate-binding protein
	lp_0176	malC	Maltose/maltodextrin ABC transporter, permease protein 1
	lp_0177	malD	Maltose/maltodextrin ABC transporter, permease protein 2
	lp_0178	malA	Maltodextrose utilization protein MalA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD