Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing malC gene

Properties
Regulog: MdxR - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: activator
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus plantarum WCFS1
Position: -103
Score: 6.32785
Sequence: TTCTGTTAACGTTAACATTA
Locus tag: lp_0175
Name: malX
Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein
Locus tag: lp_0176
Name: malC
Funciton: Maltose/maltodextrin ABC transporter, permease protein 1
Locus tag: lp_0177
Name: malD
Funciton: Maltose/maltodextrin ABC transporter, permease protein 2
Locus tag: lp_0178
Name: malA
Funciton: Maltodextrose utilization protein MalA
malX-malC-malD-malA -103 6.3 TTCTGTTAACGTTAACATTA lp_0175