Regulog Lp_3221 - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | 3 | 2 |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 3 | 2 |
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | 4 | 2 |
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| agl4 |
|
|
*
Lactobacillus casei ATCC 334 Site: position = -58 score = 6.49782 sequence = ATATGGAATCGATACCACAT Gene: LSEI_2102: Oligo-1,6-glucosidase |
|
|
|
|
*
Lactobacillus plantarum WCFS1 Site: position = -35 score = 6.38869 sequence = AAGTGGAATCGATTCCAAAT Gene: lp_3220: Oligo-1,6-glucosidase |
|
*
Lactobacillus rhamnosus GG Site: position = -39 score = 6.49782 sequence = ATATGGAATCGATACCACAT Gene: LGG_02105: Oligo-1,6-glucosidase |
|
|
|
|
|
Oligo-1,6-glucosidase |
| scrT |
|
|
Gene: LSEI_2101: PTS system, sucrose-specific IIABC component (EC 2.7.1.69) |
|
|
|
|
Gene: lp_3219: PTS system, sucrose-specific IIABC component (EC 2.7.1.69) |
|
2
Lactobacillus rhamnosus GG Gene: LGG_02104: PTS system, sucrose-specific IIABC component (EC 2.7.1.69) Gene: LGG_02103: PTS system, sucrose-specific IIABC component (EC 2.7.1.69) |
|
|
|
|
|
PTS system, sucrose-specific IIABC component (EC 2.7.1.69) |
| CRON 2. | ||||||||||||||||
| lp_3221 |
|
|
*
Lactobacillus casei ATCC 334 Site: position = -37 score = 6.28918 sequence = CTATGAAATCGATTCCATAC Gene: LSEI_2103: Predicted sugar utilization transcriptional regulator, LacI family |
|
|
|
|
*
Lactobacillus plantarum WCFS1 Site: position = -36 score = 6.18005 sequence = TTATGGAAACGATTCCAAAC Gene: lp_3221: Predicted sugar utilization transcriptional regulator, LacI family |
|
*
Lactobacillus rhamnosus GG Site: position = -38 score = 6.28918 sequence = GTATGAAATCGATTCCATAA Gene: LGG_02106: Predicted sugar utilization transcriptional regulator, LacI family |
|
|
|
|
|
Predicted sugar utilization transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |