Regulon of Lp_3221 in Lactobacillus casei ATCC 334

Properties
Regulator type:	Transcription factor
TF locus tag:	LSEI_2103
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Lp_3221 - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.3 Sequence: CTATGAAATCGATTCCATAC Locus tag: LSEI_2103 Name: lp_3221 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	LSEI_2103	lp_3221	Predicted sugar utilization transcriptional regulator, LacI family
Position: -58 Score: 6.5 Sequence: ATATGGAATCGATACCACAT Locus tag: LSEI_2102 Name: agl4 Funciton: Oligo-1,6-glucosidase Locus tag: LSEI_2101 Name: scrT Funciton: PTS system, sucrose-specific IIABC component (EC 2.7.1.69)
	LSEI_2102	agl4	Oligo-1,6-glucosidase
	LSEI_2101	scrT	PTS system, sucrose-specific IIABC component (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD