Regulon of Lp_3221 in Lactobacillus rhamnosus GG

Properties
Regulator type:	Transcription factor
TF locus tag:	LGG_02106
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Lp_3221 - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 6.5 Sequence: ATATGGAATCGATACCACAT Locus tag: LGG_02105 Name: agl4 Funciton: Oligo-1,6-glucosidase Locus tag: LGG_02104 Name: scrT Funciton: PTS system, sucrose-specific IIABC component (EC 2.7.1.69) Locus tag: LGG_02103 Name: scrT Funciton: PTS system, sucrose-specific IIABC component (EC 2.7.1.69)
	LGG_02105	agl4	Oligo-1,6-glucosidase
	LGG_02104	scrT	PTS system, sucrose-specific IIABC component (EC 2.7.1.69)
	LGG_02103	scrT	PTS system, sucrose-specific IIABC component (EC 2.7.1.69)
Position: -38 Score: 6.3 Sequence: GTATGAAATCGATTCCATAA Locus tag: LGG_02106 Name: lp_3221 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	LGG_02106	lp_3221	Predicted sugar utilization transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD