Statistics of regulated genes

Genome	Genes	Operons
Chloroflexus aggregans DSM 9485
Chloroflexus sp. Y-400-fl
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941	6	5
Roseiflexus sp. RS-1	6	5

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes						Function
CRON 1.
COG0701	Chloroflexus aggregans DSM 9485 Gene: Cagg_2028: predicted permease	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	* Roseiflexus castenholzii DSM 13941 Site: position = -33 score = 6.97791 sequence = TAAGTGATAGTAACTATCATTTA Gene: Rcas_3894: predicted permease	* Roseiflexus sp. RS-1 Site: position = -33 score = 6.50185 sequence = ACAATGATATTTACTATCATTTA Gene: RoseRS_0592: predicted permease	predicted permease
CRON 2.
Rcas_3893	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_4472: hypothetical protein	* Roseiflexus castenholzii DSM 13941 Site: position = -63 score = 5.00797 sequence = TCGTTGAAAGTAACTATCATCTG Gene: Rcas_3893: hypothetical protein	* Roseiflexus sp. RS-1 Site: position = -61 score = 5.80435 sequence = AAAATGGTAGTTGCTATCATTGA Gene: RoseRS_0845: hypothetical protein	hypothetical protein
CRON 3.
Rcas_3900	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	* Roseiflexus castenholzii DSM 13941 Site: position = -157 score = 5.61081 sequence = CAACTGATAGATAAGATCATTTG Gene: Rcas_3900: Zinc finger domain, similar to cold shock proteins	* Roseiflexus sp. RS-1 Site: position = -159 score = 5.46124 sequence = CAAATGATAGACGAGATCATTTG Gene: RoseRS_0598: Zinc finger domain, similar to cold shock proteins	Zinc finger domain, similar to cold shock proteins
CRON 4.
yciC	Chloroflexus aggregans DSM 9485 Gene: Cagg_0608: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	* Roseiflexus castenholzii DSM 13941 Site: position = -59 score = 5.62172 sequence = TCATTGATATACACTATCATCAA Gene: Rcas_2945: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	* Roseiflexus sp. RS-1 Site: position = -40 score = 5.87525 sequence = GAACTGATATGATCTATCATTTG Gene: RoseRS_3105: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
CRON 5.
fmdB	Chloroflexus aggregans DSM 9485 Gene: Cagg_0322: putative regulatory protein, FmdB family	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_2075: putative regulatory protein, FmdB family	* Roseiflexus castenholzii DSM 13941 Site: position = -50 score = 6.06062 sequence = CAAGTGATAGCATATATCACAAA Gene: Rcas_2948: putative regulatory protein, FmdB family	* Roseiflexus sp. RS-1 Site: position = -3 score = 5.96418 sequence = TAAGTGATAGCATATATCACACT Gene: RoseRS_3107: putative regulatory protein, FmdB family	putative regulatory protein, FmdB family
yciC2	Chloroflexus aggregans DSM 9485 Gene: Cagg_0321: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_4200: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Roseiflexus castenholzii DSM 13941 Gene: Rcas_2949: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Roseiflexus sp. RS-1 Gene: RoseRS_3108: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD