Regulog Zur2 - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | ||
| Chloroflexus sp. Y-400-fl | ||
| Herpetosiphon aurantiacus ATCC 23779 | ||
| Roseiflexus castenholzii DSM 13941 | 6 | 5 |
| Roseiflexus sp. RS-1 | 6 | 5 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| COG0701 |
Gene: Cagg_2028: predicted permease |
|
|
*
Roseiflexus castenholzii DSM 13941 Site: position = -33 score = 6.97791 sequence = TAAGTGATAGTAACTATCATTTA Gene: Rcas_3894: predicted permease |
*
Roseiflexus sp. RS-1 Site: position = -33 score = 6.50185 sequence = ACAATGATATTTACTATCATTTA Gene: RoseRS_0592: predicted permease |
predicted permease |
| CRON 2. | ||||||
| Rcas_3893 |
|
|
Gene: Haur_4472: hypothetical protein |
*
Roseiflexus castenholzii DSM 13941 Site: position = -63 score = 5.00797 sequence = TCGTTGAAAGTAACTATCATCTG Gene: Rcas_3893: hypothetical protein |
*
Roseiflexus sp. RS-1 Site: position = -61 score = 5.80435 sequence = AAAATGGTAGTTGCTATCATTGA Gene: RoseRS_0845: hypothetical protein |
hypothetical protein |
| CRON 3. | ||||||
| Rcas_3900 |
|
|
|
*
Roseiflexus castenholzii DSM 13941 Site: position = -157 score = 5.61081 sequence = CAACTGATAGATAAGATCATTTG Gene: Rcas_3900: Zinc finger domain, similar to cold shock proteins |
*
Roseiflexus sp. RS-1 Site: position = -159 score = 5.46124 sequence = CAAATGATAGACGAGATCATTTG Gene: RoseRS_0598: Zinc finger domain, similar to cold shock proteins |
Zinc finger domain, similar to cold shock proteins |
| CRON 4. | ||||||
| yciC |
Gene: Cagg_0608: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
|
*
Roseiflexus castenholzii DSM 13941 Site: position = -59 score = 5.62172 sequence = TCATTGATATACACTATCATCAA Gene: Rcas_2945: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
*
Roseiflexus sp. RS-1 Site: position = -40 score = 5.87525 sequence = GAACTGATATGATCTATCATTTG Gene: RoseRS_3105: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
| CRON 5. | ||||||
| fmdB |
Gene: Cagg_0322: putative regulatory protein, FmdB family |
|
Gene: Haur_2075: putative regulatory protein, FmdB family |
*
Roseiflexus castenholzii DSM 13941 Site: position = -50 score = 6.06062 sequence = CAAGTGATAGCATATATCACAAA Gene: Rcas_2948: putative regulatory protein, FmdB family |
*
Roseiflexus sp. RS-1 Site: position = -3 score = 5.96418 sequence = TAAGTGATAGCATATATCACACT Gene: RoseRS_3107: putative regulatory protein, FmdB family |
putative regulatory protein, FmdB family |
| yciC2 |
Gene: Cagg_0321: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
|
Gene: Haur_4200: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Gene: Rcas_2949: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Gene: RoseRS_3108: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |