Regulon of Zur2 in Roseiflexus sp. RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	RoseRS_0593
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur2 - Chloroflexia
Statistics of regulated genes:
- Genes	6
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 5.8 Sequence: AAAATGGTAGTTGCTATCATTGA Locus tag: RoseRS_0845 Name: Rcas_3893 Funciton: hypothetical protein
	RoseRS_0845	Rcas_3893	hypothetical protein
Position: -3 Score: 6 Sequence: TAAGTGATAGCATATATCACACT Locus tag: RoseRS_3107 Name: fmdB Funciton: putative regulatory protein, FmdB family Locus tag: RoseRS_3108 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	RoseRS_3107	fmdB	putative regulatory protein, FmdB family
	RoseRS_3108	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -159 Score: 5.5 Sequence: CAAATGATAGACGAGATCATTTG Locus tag: RoseRS_0598 Name: Rcas_3900 Funciton: Zinc finger domain, similar to cold shock proteins
	RoseRS_0598	Rcas_3900	Zinc finger domain, similar to cold shock proteins
Position: -40 Score: 5.9 Sequence: GAACTGATATGATCTATCATTTG Locus tag: RoseRS_3105 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	RoseRS_3105	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -33 Score: 6.5 Sequence: ACAATGATATTTACTATCATTTA Locus tag: RoseRS_0592 Name: COG0701 Funciton: predicted permease
	RoseRS_0592	COG0701	predicted permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD