Regulon of Zur2 in Roseiflexus castenholzii DSM 13941

Properties
Regulator type:	Transcription factor
TF locus tag:	Rcas_3895
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur2 - Chloroflexia
Statistics of regulated genes:
- Genes	6
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 5 Sequence: TCGTTGAAAGTAACTATCATCTG Locus tag: Rcas_3893 Name: Rcas_3893 Funciton: hypothetical protein
	Rcas_3893	Rcas_3893	hypothetical protein
Position: -50 Score: 6.1 Sequence: CAAGTGATAGCATATATCACAAA Locus tag: Rcas_2948 Name: fmdB Funciton: putative regulatory protein, FmdB family Locus tag: Rcas_2949 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Rcas_2948	fmdB	putative regulatory protein, FmdB family
	Rcas_2949	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -59 Score: 5.6 Sequence: TCATTGATATACACTATCATCAA Locus tag: Rcas_2945 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Rcas_2945	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -157 Score: 5.6 Sequence: CAACTGATAGATAAGATCATTTG Locus tag: Rcas_3900 Name: Rcas_3900 Funciton: Zinc finger domain, similar to cold shock proteins
	Rcas_3900	Rcas_3900	Zinc finger domain, similar to cold shock proteins
Position: -33 Score: 7 Sequence: TAAGTGATAGTAACTATCATTTA Locus tag: Rcas_3894 Name: COG0701 Funciton: predicted permease
	Rcas_3894	COG0701	predicted permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD