Regulog Zur2 - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - Zur
- By taxonomy - Comamonadaceae
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||
| Acidovorax sp. JS42 | ||
| Comamonas testosteroni KF-1 | ||
| Delftia acidovorans SPH-1 | ||
| Leptothrix cholodnii SP-6 | 5 | 1 |
| Methylibium petroleiphilum PM1 | ||
| Polaromonas naphthalenivorans CJ2 | ||
| Polaromonas sp. JS666 | ||
| Rhodoferax ferrireducens DSM 15236 | ||
| Variovorax paradoxus S110 | ||
| Verminephrobacter eiseniae EF01-2 | 4 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| zur2 |
|
|
|
|
*
Leptothrix cholodnii SP-6 Site: position = -111 score = 5.90981 sequence = CGTATCATTTGACGCATGAAGGC Gene: Lcho_3564: Zinc uptake regulation protein Zur |
|
|
|
|
|
*
Verminephrobacter eiseniae EF01-2 Site: position = -98 score = 6.11376 sequence = TTTTTCATGGGCCAGATGATAGT Gene: Veis_3389: Zinc uptake regulation protein Zur |
Zinc uptake regulation protein Zur |
| Lcho_3563 |
|
|
|
|
Gene: Lcho_3563: Hypothetical protein |
|
|
|
|
|
|
Hypothetical protein |
| znuC |
|
|
|
|
Gene: Lcho_3562: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
|
|
*
Verminephrobacter eiseniae EF01-2 Site: position = -143 score = 6.11376 sequence = ACTATCATCTGGCCCATGAAAAA Gene: Veis_3390: Zinc ABC transporter, ATP-binding protein ZnuC |
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
|
|
|
|
Gene: Lcho_3561: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
|
|
|
|
Gene: Veis_3391: Zinc ABC transporter, inner membrane permease protein ZnuB |
Zinc ABC transporter, inner membrane permease protein ZnuB |
| znuA |
|
|
|
|
Gene: Lcho_3560: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
|
|
Gene: Veis_3392: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Zinc ABC transporter, periplasmic-binding protein ZnuA |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |