Regulog Zur2 - Comamonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Comamonadaceae
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1
Leptothrix cholodnii SP-6	5	1
Methylibium petroleiphilum PM1
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2	4	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
zur2	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	* Leptothrix cholodnii SP-6 Site: position = -111 score = 5.90981 sequence = CGTATCATTTGACGCATGAAGGC Gene: Lcho_3564: Zinc uptake regulation protein Zur	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	* Verminephrobacter eiseniae EF01-2 Site: position = -98 score = 6.11376 sequence = TTTTTCATGGGCCAGATGATAGT Gene: Veis_3389: Zinc uptake regulation protein Zur	Zinc uptake regulation protein Zur
Lcho_3563	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6 Gene: Lcho_3563: Hypothetical protein	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Hypothetical protein
znuC	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6 Gene: Lcho_3562: Zinc ABC transporter, ATP-binding protein ZnuC	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	* Verminephrobacter eiseniae EF01-2 Site: position = -143 score = 6.11376 sequence = ACTATCATCTGGCCCATGAAAAA Gene: Veis_3390: Zinc ABC transporter, ATP-binding protein ZnuC	Zinc ABC transporter, ATP-binding protein ZnuC
znuB	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6 Gene: Lcho_3561: Zinc ABC transporter, inner membrane permease protein ZnuB	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_3391: Zinc ABC transporter, inner membrane permease protein ZnuB	Zinc ABC transporter, inner membrane permease protein ZnuB
znuA	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6 Gene: Lcho_3560: Zinc ABC transporter, periplasmic-binding protein ZnuA	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_3392: Zinc ABC transporter, periplasmic-binding protein ZnuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur2 - Comamonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --