Regulon of Zur2 in Verminephrobacter eiseniae EF01-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Veis_3389
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur2 - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Comamonadaceae
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -98 Score: 6.1 Sequence: TTTTTCATGGGCCAGATGATAGT Locus tag: Veis_3389 Name: zur2 Funciton: Zinc uptake regulation protein Zur
	Veis_3389	zur2	Zinc uptake regulation protein Zur
Position: -143 Score: 6.1 Sequence: ACTATCATCTGGCCCATGAAAAA Locus tag: Veis_3390 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Veis_3391 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Veis_3392 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Veis_3390	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Veis_3391	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Veis_3392	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD