Regulon of Zur2 in Leptothrix cholodnii SP-6

Properties
Regulator type:	Transcription factor
TF locus tag:	Lcho_3564
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur2 - Comamonadaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Comamonadaceae
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -111 Score: 5.9 Sequence: CGTATCATTTGACGCATGAAGGC Locus tag: Lcho_3564 Name: zur2 Funciton: Zinc uptake regulation protein Zur Locus tag: Lcho_3563 Name: Lcho_3563 Funciton: Hypothetical protein Locus tag: Lcho_3562 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Lcho_3561 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Lcho_3560 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Lcho_3564	zur2	Zinc uptake regulation protein Zur
	Lcho_3563	Lcho_3563	Hypothetical protein
	Lcho_3562	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Lcho_3561	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Lcho_3560	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD