Regulog YybA - Lactobacillaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MarR
Regulation mode:
Biological process:	unknown
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - MarR
By pathway - unknown

Statistics of regulated genes
Genome	Genes	Operons
Lactobacillus acidophilus NCFM	2	1
Lactobacillus brevis ATCC 367
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533	2	1
Lactobacillus plantarum WCFS1
Lactobacillus reuteri JCM 1112
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K
Lactobacillus salivarius subsp. salivarius UCC118
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
yybA	* Lactobacillus acidophilus NCFM Site: position = -51 score = 7.81073 sequence = TTTTTGTTGCAAATGCAACAAAAA Gene: LBA1663: Predicted transcriptional regulator, MarR family	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	* Lactobacillus johnsonii NCC 533 Site: position = -67 score = 7.81073 sequence = TTATTGTCGCATTTGCAACAATAA Gene: LJ0661: Predicted transcriptional regulator, MarR family	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Predicted transcriptional regulator, MarR family
LBA1664	Lactobacillus acidophilus NCFM Gene: LBA1664: Protease synthase and sporulation negative regulatory protein PAI 1	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533 Gene: LJ0662: Protease synthase and sporulation negative regulatory protein PAI 1	Lactobacillus plantarum WCFS1	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Protease synthase and sporulation negative regulatory protein PAI 1

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog YybA - Lactobacillaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --