Regulon of YybA in Lactobacillus johnsonii NCC 533

Properties
Regulator type:	Transcription factor
TF locus tag:	LJ0661
Regulator family:	MarR
Regulation mode:
Biological process:	unknown
Effector:
Regulog:	YybA - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - MarR
By pathway - unknown

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 7.8 Sequence: TTATTGTCGCATTTGCAACAATAA Locus tag: LJ0661 Name: yybA Funciton: Predicted transcriptional regulator, MarR family Locus tag: LJ0662 Name: LBA1664 Funciton: Protease synthase and sporulation negative regulatory protein PAI 1
	LJ0661	yybA	Predicted transcriptional regulator, MarR family
	LJ0662	LBA1664	Protease synthase and sporulation negative regulatory protein PAI 1

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD