Profile of regulator YybA in Lactobacillaceae
| Regulator family: | MarR |
| Regulation mode: | |
| Biological process: | unknown |
| Effector: | |
| Regulog: | YybA - Lactobacillaceae |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - MarR
- By pathway - unknown
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Lactobacillus acidophilus NCFM | |||||
| LBA1663 | yybA | -51 | 7.8 | TTTTTGTTGCAAATGCAACAAAAA | |
| Lactobacillus johnsonii NCC 533 | |||||
| LJ0661 | yybA | -67 | 7.8 | TTATTGTCGCATTTGCAACAATAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |