Regulon of YybA in Lactobacillus acidophilus NCFM
| Regulator type: | Transcription factor |
| TF locus tag: | LBA1663 |
| Regulator family: | MarR |
| Regulation mode: | |
| Biological process: | unknown |
| Effector: | |
| Regulog: | YybA - Lactobacillaceae |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - MarR
- By pathway - unknown
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -51
Score: 7.8 Sequence: TTTTTGTTGCAAATGCAACAAAAA
Locus tag: LBA1663
Name: yybA Funciton: Predicted transcriptional regulator, MarR family
Locus tag: LBA1664
Name: LBA1664 Funciton: Protease synthase and sporulation negative regulatory protein PAI 1 |
|||
|
yybA
|
Predicted transcriptional regulator, MarR family
|
||
|
LBA1664
|
Protease synthase and sporulation negative regulatory protein PAI 1
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |