Regulog TreR - Lactobacillaceae

Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - GntR/Others
- By effector - Trehalose-6-phosphate
- By pathway - Trehalose utilization
Genome | Genes | Operons |
---|---|---|
Lactobacillus acidophilus NCFM | 3 | 2 |
Lactobacillus brevis ATCC 367 | ||
Lactobacillus casei ATCC 334 | 3 | 1 |
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
Lactobacillus fermentum IFO 3956 | ||
Lactobacillus helveticus DPC 4571 | ||
Lactobacillus johnsonii NCC 533 | 3 | 2 |
Lactobacillus plantarum WCFS1 | 3 | 1 |
Lactobacillus reuteri JCM 1112 | ||
Lactobacillus rhamnosus GG | 3 | 1 |
Lactobacillus sakei subsp. sakei 23K | 3 | 2 |
Lactobacillus salivarius subsp. salivarius UCC118 | 3 | 2 |
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | 3 | 1 |
Oenococcus oeni PSU-1 | 3 | 1 |
Pediococcus pentosaceus ATCC 25745 | 3 | 2 |
Genes | Function | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||||||||
treP |
*
Lactobacillus acidophilus NCFM Site: position = -68 score = 6.54405 sequence = CAACTTGTATATACAAGTTT Site: position = -146 score = 5.37691 sequence = ATAAATGTATAGACAAGTAA Gene: LBA1012: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
|
Gene: LSEI_0631: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
|
|
|
*
Lactobacillus johnsonii NCC 533 Site: position = -75 score = 6.08495 sequence = CAACTTGTACAGACAAGTAT Site: position = -164 score = 5.18226 sequence = ACACTTGATTAGACAAGTAA Gene: LJ0760: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
3
Lactobacillus plantarum WCFS1 Gene: lp_0264: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) Gene: lp_0265: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) Gene: lp_3240: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
|
Gene: LGG_00603: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -78 score = 6.01017 sequence = CAACTTGTCTATACATGTTG Gene: LSA1200: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -158 score = 4.8101 sequence = ATAGATGTATATACAATATA Site: position = -68 score = 6.34987 sequence = CAACTTGTATATACAAGTGA Gene: LSL_1512: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*2
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Gene: LEUM_0508: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) Site: position = -40 score = 5.81875 sequence = TAACTAGTACGTACAAGTTG Gene: LEUM_0507: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*2
Oenococcus oeni PSU-1 Site: position = -31 score = 5.54009 sequence = AAAGTTGTACGTACAAGTGA Gene: OEOE_1342: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) Gene: OEOE_1341: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*
Pediococcus pentosaceus ATCC 25745 Site: position = -95 score = 6.12108 sequence = CATCTTGTATATACAAGTTT Site: position = -171 score = 5.78258 sequence = TAACTAGTATATACAAGGTA Gene: PEPE_1804: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69) |
treA |
Gene: LBA1014: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
|
Gene: LSEI_0630: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
|
|
|
Gene: LJ0758: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: lp_0263: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
|
Gene: LGG_00602: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: LSA1199: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: LSL_1514: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: LEUM_0509: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: OEOE_1340: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Gene: PEPE_1806: Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
Trehalose-6-phosphate hydrolase (EC 3.2.1.93) |
treR |
*
Lactobacillus acidophilus NCFM Site: position = -56 score = 5.1928 sequence = TTACTTGTCTATACATTTAT Site: position = -134 score = 6.59816 sequence = AAACTTGTATATACAAGTTG Gene: LBA1013: Trehalose utilization transcriptional repressor TreR, GntR family |
|
*
Lactobacillus casei ATCC 334 Site: position = -61 score = 5.20541 sequence = ATACCTGTACGTACAGGTAA Gene: LSEI_0629: Trehalose utilization transcriptional repressor TreR, GntR family |
|
|
|
*
Lactobacillus johnsonii NCC 533 Site: position = 39 score = 5.9293 sequence = ATACTTGTCTGTACAAGTTG Gene: LJ0759: Trehalose utilization transcriptional repressor TreR, GntR family |
*
Lactobacillus plantarum WCFS1 Site: position = -59 score = 5.56169 sequence = CAACTTGTCTAAACAAGTCT Gene: lp_0262: Trehalose utilization transcriptional repressor TreR, GntR family |
|
*
Lactobacillus rhamnosus GG Site: position = -61 score = 5.61797 sequence = ATACCTGTACGTACAAGTAG Gene: LGG_00601: Trehalose utilization transcriptional repressor TreR, GntR family |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -113 score = 6.07624 sequence = CAACATGTATAGACAAGTTG Gene: LSA1201: Trehalose utilization transcriptional repressor TreR, GntR family |
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -162 score = 6.25145 sequence = TCACTTGTATATACAAGTTG Gene: LSL_1513: Trehalose utilization transcriptional repressor TreR, GntR family |
Gene: LEUM_0510: Trehalose utilization transcriptional repressor TreR, GntR family |
Gene: OEOE_1339: Trehalose utilization transcriptional repressor TreR, GntR family |
*
Pediococcus pentosaceus ATCC 25745 Site: position = -66 score = 5.68826 sequence = TACCTTGTATATACTAGTTA Site: position = -142 score = 6.17518 sequence = AAACTTGTATATACAAGATG Gene: PEPE_1805: Trehalose utilization transcriptional repressor TreR, GntR family |
Trehalose utilization transcriptional regulator TreR, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |