Regulon of TreR in Lactobacillus johnsonii NCC 533

Properties
Regulator type:	Transcription factor
TF locus tag:	LJ0759
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose-6-phosphate
Regulog:	TreR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By effector - Trehalose-6-phosphate
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: 39 Score: 5.9 Sequence: ATACTTGTCTGTACAAGTTG Locus tag: LJ0759 Name: treR Funciton: Trehalose utilization transcriptional repressor TreR, GntR family Locus tag: LJ0758 Name: treA Funciton: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
	LJ0759	treR	Trehalose utilization transcriptional repressor TreR, GntR family
	LJ0758	treA	Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
Position: -164 Score: 5.2 Sequence: ACACTTGATTAGACAAGTAA Position: -75 Score: 6.1 Sequence: CAACTTGTACAGACAAGTAT Locus tag: LJ0760 Name: treP Funciton: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
	LJ0760	treP	Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD