Regulon of TreR in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type:	Transcription factor
TF locus tag:	LSL_1513
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose-6-phosphate
Regulog:	TreR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By effector - Trehalose-6-phosphate
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -162 Score: 6.3 Sequence: TCACTTGTATATACAAGTTG Locus tag: LSL_1513 Name: treR Funciton: Trehalose utilization transcriptional repressor TreR, GntR family Locus tag: LSL_1514 Name: treA Funciton: Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
	LSL_1513	treR	Trehalose utilization transcriptional repressor TreR, GntR family
	LSL_1514	treA	Trehalose-6-phosphate hydrolase (EC 3.2.1.93)
Position: -158 Score: 4.8 Sequence: ATAGATGTATATACAATATA Position: -68 Score: 6.3 Sequence: CAACTTGTATATACAAGTGA Locus tag: LSL_1512 Name: treP Funciton: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
	LSL_1512	treP	Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD