Regulog PflR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | DeoR |
| Regulation mode: | repressor |
| Biological process: | Formate metabolism |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - DeoR
- By pathway - Formate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | 3 | 2 |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | 6 | 3 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | 6 | 3 |
| Streptococcus gallolyticus UCN34 | ||
| Streptococcus gordonii str. Challis substr. CH1 | 6 | 3 |
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | 5 | 3 |
| Streptococcus pneumoniae TIGR4 | 6 | 3 |
| Streptococcus pyogenes M1 GAS | 6 | 3 |
| Streptococcus sanguinis SK36 | 6 | 3 |
| Streptococcus suis 05ZYH33 | 4 | 2 |
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J | 5 | 3 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| pflR |
|
|
*
Streptococcus agalactiae 2603V/R Site: position = -82 score = 5.74597 sequence = ACGTAACAAAGTCAATTACGA Gene: SAG0326: Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -80 score = 6.07916 sequence = ACGTAAATAAATCAATTACGA Gene: SDEG_0170: Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -83 score = 6.07916 sequence = ACGTAAATAAATCAATTACGA Gene: Sez_1814: Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
|
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -79 score = 5.77661 sequence = ACGCAATAAATACAATTACGA Gene: SGO_1793: Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
|
*
Streptococcus mutans UA159 Site: position = -85 score = 6.02288 sequence = ACGAAACAAAATCAATTACGA Gene: SMU.491: Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
*
Streptococcus pneumoniae TIGR4 Site: position = -82 score = 5.89671 sequence = ACGAAAGAAAAACAATTACGA Gene: SP_0246: Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
*
Streptococcus pyogenes M1 GAS Site: position = -83 score = 6.07916 sequence = ACGTAAATAAATCAATTACGA Gene: SPy2054: Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
*
Streptococcus sanguinis SK36 Site: position = -85 score = 5.63726 sequence = TAGAAAGAAAAACAATTACGA Gene: SSA_0278: Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
*
Streptococcus suis 05ZYH33 Site: position = -91 score = 4.94841 sequence = AAGAAAGTTTTACAATTACGA Gene: SSU05_0706: Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
|
*
Streptococcus uberis 0140J Site: position = -86 score = 6.04378 sequence = ACGTAAATAAATCAATTACGT Gene: SUB0157: Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
Pyruvate-formate lyase operon transcriptional regulator, DeoR family |
| SPy2053 |
|
|
Gene: SAG0327: Predicted transcriptional regulator, DeoR family |
Gene: SDEG_0171: Predicted transcriptional regulator, DeoR family |
Gene: Sez_1813: Predicted transcriptional regulator, DeoR family |
|
Gene: SGO_1792: Predicted transcriptional regulator, DeoR family |
|
|
Gene: SP_0247: Predicted transcriptional regulator, DeoR family |
Gene: SPy2053: Predicted transcriptional regulator, DeoR family |
Gene: SSA_0279: Predicted transcriptional regulator, DeoR family |
2
Streptococcus suis 05ZYH33 Gene: SSU05_0708: Predicted transcriptional regulator, DeoR family Gene: SSU05_0707: Predicted transcriptional regulator, DeoR family |
|
Gene: SUB0158: Predicted transcriptional regulator, DeoR family |
Predicted transcriptional regulator, DeoR family |
| CRON 2. | ||||||||||||||||
| pflA |
|
|
*
Streptococcus agalactiae 2603V/R Site: position = -59 score = 4.78358 sequence = TCGTAATTGACTTTGTTACGT Gene: SAG0325: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -63 score = 5.75563 sequence = TCGTAATTGATTTATTTACGT Gene: SDEG_0169: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = 34 score = 5.75563 sequence = TCGTAATTGATTTATTTACGT Gene: Sez_1815: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
|
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -60 score = 5.24234 sequence = TCGTAATTGTATTTATTGCGT Gene: SGO_1794: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
|
*
Streptococcus mutans UA159 Site: position = -66 score = 5.08642 sequence = TCGTAATTGATTTTGTTTCGT Gene: SMU.490: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
*
Streptococcus pneumoniae TIGR4 Site: position = -60 score = 5.1872 sequence = TCGTAATTGTTTTTCTTTCGT Gene: SP_0245: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
*
Streptococcus pyogenes M1 GAS Site: position = -63 score = 5.75563 sequence = TCGTAATTGATTTATTTACGT Gene: SPy2055: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
*
Streptococcus sanguinis SK36 Site: position = -33 score = 4.93144 sequence = TCGTAATTGTTTTTCTTTCTA Gene: SSA_0277: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
*
Streptococcus suis 05ZYH33 Site: position = -61 score = 4.95488 sequence = TCGTAATTGTAAAACTTTCTT Gene: SSU05_0705: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
|
*
Streptococcus uberis 0140J Site: position = -61 score = 5.86501 sequence = ACGTAATTGATTTATTTACGT Gene: SUB0156: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) |
| CRON 3. | ||||||||||||||||
| pflB |
|
|
Gene: SAG0331: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -41 score = 4.87226 sequence = AAGAAACATTTATAATTTCGT Gene: SDEG_0175: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -42 score = 5.08444 sequence = AAGAAAGTTATTTAATTTCGT Gene: Sez_1808: Pyruvate formate-lyase (EC 2.3.1.54) |
|
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -39 score = 5.56167 sequence = AAGAAATAAAAATAATTTCAT Gene: SGO_1788: Pyruvate formate-lyase (EC 2.3.1.54) |
|
*
Streptococcus mutans UA159 Site: position = -41 score = 5.10945 sequence = AAGAAATTTAATATATTACGA Gene: SMU.493: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Streptococcus pneumoniae TIGR4 Site: position = -37 score = 5.73189 sequence = AAGAAATAAAAATATTTTCGA Gene: SP_0251: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Streptococcus pyogenes M1 GAS Site: position = -41 score = 4.4107 sequence = AAGAAACGTTTATAATTTCGT Gene: SPy2049: Pyruvate formate-lyase (EC 2.3.1.54) |
*
Streptococcus sanguinis SK36 Site: position = -39 score = 5.33629 sequence = AAGAAATAAATTAAATTTCAT Gene: SSA_0285: Pyruvate formate-lyase (EC 2.3.1.54) |
Gene: SSU05_0714: Pyruvate formate-lyase (EC 2.3.1.54) |
|
*
Streptococcus uberis 0140J Site: position = -42 score = 5.27283 sequence = AAGAAACAAAAATGTTTACGA Gene: SUB0160: Pyruvate formate-lyase (EC 2.3.1.54) |
Pyruvate formate-lyase (EC 2.3.1.54) |
| tal |
|
|
Gene: SAG0332: transaldolase family protein |
Gene: SDEG_0176: transaldolase family protein |
Gene: Sez_1807: transaldolase family protein |
|
Gene: SGO_1787: transaldolase family protein |
|
Gene: SMU.494: transaldolase family protein |
Gene: SP_0252: transaldolase family protein |
Gene: SPy2048: transaldolase family protein |
Gene: SSA_0286: transaldolase family protein |
Gene: SSU05_0715: transaldolase family protein |
|
Gene: SUB0161: transaldolase family protein |
transaldolase family protein |
| gldA |
|
|
Gene: SAG0333: Glycerol dehydrogenase (EC 1.1.1.6) |
Gene: SDEG_0177: Glycerol dehydrogenase (EC 1.1.1.6) |
Gene: Sez_1806: Glycerol dehydrogenase (EC 1.1.1.6) |
|
Gene: SGO_1786: Glycerol dehydrogenase (EC 1.1.1.6) |
|
Gene: SMU.495: Glycerol dehydrogenase (EC 1.1.1.6) |
Gene: SP_0253: Glycerol dehydrogenase (EC 1.1.1.6) |
Gene: SPy2047: Glycerol dehydrogenase (EC 1.1.1.6) |
Gene: SSA_0287: Glycerol dehydrogenase (EC 1.1.1.6) |
2
Streptococcus suis 05ZYH33 Gene: SSU05_0716: Glycerol dehydrogenase (EC 1.1.1.6) Gene: SSU05_0717: Glycerol dehydrogenase (EC 1.1.1.6) |
|
|
Glycerol dehydrogenase (EC 1.1.1.6) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |