Regulon of PflR in Streptococcus gordonii str. Challis substr. CH1

Properties
Regulator type:	Transcription factor
TF locus tag:	SGO_1793
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Formate metabolism
Effector:
Regulog:	PflR - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - DeoR
By pathway - Formate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 5.2 Sequence: TCGTAATTGTATTTATTGCGT Locus tag: SGO_1794 Name: pflA Funciton: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
	SGO_1794	pflA	Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
Position: -39 Score: 5.6 Sequence: AAGAAATAAAAATAATTTCAT Locus tag: SGO_1788 Name: pflB Funciton: Pyruvate formate-lyase (EC 2.3.1.54) Locus tag: SGO_1787 Name: tal Funciton: transaldolase family protein Locus tag: SGO_1786 Name: gldA Funciton: Glycerol dehydrogenase (EC 1.1.1.6)
	SGO_1788	pflB	Pyruvate formate-lyase (EC 2.3.1.54)
	SGO_1787	tal	transaldolase family protein
	SGO_1786	gldA	Glycerol dehydrogenase (EC 1.1.1.6)
Position: -79 Score: 5.8 Sequence: ACGCAATAAATACAATTACGA Locus tag: SGO_1793 Name: pflR Funciton: Pyruvate-formate lyase operon transcriptional regulator, DeoR family Locus tag: SGO_1792 Name: SPy2053 Funciton: Predicted transcriptional regulator, DeoR family
	SGO_1793	pflR	Pyruvate-formate lyase operon transcriptional regulator, DeoR family
	SGO_1792	SPy2053	Predicted transcriptional regulator, DeoR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD