Regulon of PflR in Streptococcus uberis 0140J

Properties
Regulator type:	Transcription factor
TF locus tag:	SUB0157
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Formate metabolism
Effector:
Regulog:	PflR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - DeoR
By pathway - Formate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 5.9 Sequence: ACGTAATTGATTTATTTACGT Locus tag: SUB0156 Name: pflA Funciton: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
	SUB0156	pflA	Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
Position: -42 Score: 5.3 Sequence: AAGAAACAAAAATGTTTACGA Locus tag: SUB0160 Name: pflB Funciton: Pyruvate formate-lyase (EC 2.3.1.54) Locus tag: SUB0161 Name: tal Funciton: transaldolase family protein
	SUB0160	pflB	Pyruvate formate-lyase (EC 2.3.1.54)
	SUB0161	tal	transaldolase family protein
Position: -86 Score: 6 Sequence: ACGTAAATAAATCAATTACGT Locus tag: SUB0157 Name: pflR Funciton: Pyruvate-formate lyase operon transcriptional regulator, DeoR family Locus tag: SUB0158 Name: SPy2053 Funciton: Predicted transcriptional regulator, DeoR family
	SUB0157	pflR	Pyruvate-formate lyase operon transcriptional regulator, DeoR family
	SUB0158	SPy2053	Predicted transcriptional regulator, DeoR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD