Regulon of PflR in Streptococcus equi subsp. zooepidemicus MGCS10565

Properties
Regulator type:	Transcription factor
TF locus tag:	Sez_1814
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Formate metabolism
Effector:
Regulog:	PflR - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - DeoR
By pathway - Formate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: 34 Score: 5.8 Sequence: TCGTAATTGATTTATTTACGT Locus tag: Sez_1815 Name: pflA Funciton: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
	Sez_1815	pflA	Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
Position: -42 Score: 5.1 Sequence: AAGAAAGTTATTTAATTTCGT Locus tag: Sez_1808 Name: pflB Funciton: Pyruvate formate-lyase (EC 2.3.1.54) Locus tag: Sez_1807 Name: tal Funciton: transaldolase family protein Locus tag: Sez_1806 Name: gldA Funciton: Glycerol dehydrogenase (EC 1.1.1.6)
	Sez_1808	pflB	Pyruvate formate-lyase (EC 2.3.1.54)
	Sez_1807	tal	transaldolase family protein
	Sez_1806	gldA	Glycerol dehydrogenase (EC 1.1.1.6)
Position: -83 Score: 6.1 Sequence: ACGTAAATAAATCAATTACGA Locus tag: Sez_1814 Name: pflR Funciton: Pyruvate-formate lyase operon transcriptional regulator, DeoR family Locus tag: Sez_1813 Name: SPy2053 Funciton: Predicted transcriptional regulator, DeoR family
	Sez_1814	pflR	Pyruvate-formate lyase operon transcriptional regulator, DeoR family
	Sez_1813	SPy2053	Predicted transcriptional regulator, DeoR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD