Regulog ScrR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - LacI
- By effector - Sucrose-6-phosphate
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | 3 | 2 |
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | 2 | 2 |
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | 3 | 2 |
| Lactobacillus plantarum WCFS1 | 5 | 2 |
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | 3 | 2 |
| Lactobacillus salivarius subsp. salivarius UCC118 | 3 | 2 |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 | 6 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| scrB |
*
Lactobacillus acidophilus NCFM Site: position = -80 score = 6.2351 sequence = TATGATAAACGTTTGACACA Site: position = -168 score = 6.39299 sequence = TATGTCAATCGTTTGACACA Gene: LBA0400: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
Gene: LSEI_2104: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
*
Lactobacillus fermentum IFO 3956 Site: position = -73 score = 5.47862 sequence = TATGCTAATCGATTGACAGC Gene: LAF_1580: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
*
Lactobacillus johnsonii NCC 533 Site: position = -164 score = 5.93716 sequence = TATGTCAAGCGCTTATCATA Site: position = -87 score = 5.27266 sequence = ACTGTTATTCGTTTGACATA Gene: LJ0518: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
*
Lactobacillus plantarum WCFS1 Site: position = -171 score = 6.00893 sequence = TATGTCAAGCGTTTGATACA Site: position = -82 score = 6.42881 sequence = AATGTCAAACGATTGACATA Gene: lp_0187: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
Gene: LGG_02107: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -77 score = 5.93797 sequence = AATGACATACGTTTGACATA Site: position = -145 score = 6.23871 sequence = TATGTCAAACGATTATCATA Gene: LSA1793: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -81 score = 5.85375 sequence = TATGTTATACGATTGACAGT Gene: LSL_0065: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -171 score = 6.00893 sequence = TATGTCAAGCGTTTGATACA Site: position = -82 score = 6.42881 sequence = AATGTCAAACGATTGACATA Gene: PEPE_0519: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
| scrR |
Gene: LBA0399: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
|
Gene: LBUL_1639: Sucrose utilization transcriptional regulator ScrR, LacI family |
Gene: LAF_1819: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
Gene: LJ0517: Sucrose utilization transcriptional regulator ScrR, LacI family |
Gene: lp_0188: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
|
Gene: LSA1794: Sucrose utilization transcriptional regulator ScrR, LacI family |
Gene: LSL_0064: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
|
Gene: PEPE_0520: Sucrose utilization transcriptional regulator ScrR, LacI family |
Sucrose utilization transcriptional regulator ScrR, LacI family |
| agl4 |
|
|
|
|
|
|
|
Gene: lp_0189: Oligo-1,6-glucosidase (EC 3.2.1.10) |
|
Gene: LGG_02696: Oligo-1,6-glucosidase (EC 3.2.1.10) |
|
|
|
|
Gene: PEPE_0521: Oligo-1,6-glucosidase (EC 3.2.1.10) |
Oligo-1,6-glucosidase (EC 3.2.1.10) |
| CRON 2. | ||||||||||||||||
| scrA |
*
Lactobacillus acidophilus NCFM Site: position = -174 score = 6.08229 sequence = TGTGTCAAACGTTTATCATA Site: position = -86 score = 6.51618 sequence = TGTGTCAAACGATTGACATA Gene: LBA0401: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) |
|
|
|
*
Lactobacillus fermentum IFO 3956 Site: position = -106 score = 5.94762 sequence = TATGTCAAACGGTTGACAAT Gene: LAF_1578: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) |
|
*
Lactobacillus johnsonii NCC 533 Site: position = -91 score = 6.09441 sequence = TATGATAAGCGCTTGACATA Site: position = -168 score = 5.74614 sequence = TATGTCAAACGAATAACAGT Gene: LJ0519: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*
Lactobacillus plantarum WCFS1 Site: position = -193 score = 6.47461 sequence = TATGTCAATCGTTTGACATT Site: position = -104 score = 6.06215 sequence = TGTATCAAACGCTTGACATA Gene: lp_0185: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) |
|
|
*
Lactobacillus sakei subsp. sakei 23K Site: position = -169 score = 6.05288 sequence = TATGTCAAACGTATGTCATT Site: position = -101 score = 6.27721 sequence = TATGATAATCGTTTGACATA Gene: LSA1792: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) |
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -107 score = 6.19044 sequence = TGTGATAAACGATTGACATA Gene: LSL_0066: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) |
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -104 score = 6.06215 sequence = TGTATCAAACGCTTGACATA Site: position = -193 score = 6.47461 sequence = TATGTCAATCGTTTGACATT Gene: PEPE_0518: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) |
Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) |
| agaB |
|
|
Gene: LSEI_2079: Alpha-galactosidase (EC 3.2.1.22) |
|
|
|
|
|
|
Gene: LGG_02079: Alpha-galactosidase (EC 3.2.1.22) |
Gene: LSA1795: Alpha-galactosidase (EC 3.2.1.22) |
|
|
|
Gene: PEPE_0517: Alpha-galactosidase (EC 3.2.1.22) |
Alpha-galactosidase (EC 3.2.1.22) |
| scrK |
|
|
|
|
|
|
|
Gene: lp_0184: Fructokinase (EC 2.7.1.4) |
|
|
|
|
|
|
Gene: PEPE_0516: Fructokinase (EC 2.7.1.4) |
Fructokinase (EC 2.7.1.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |