Regulon of ScrR in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type:	Transcription factor
TF locus tag:	LSL_0064
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -107 Score: 6.2 Sequence: TGTGATAAACGATTGACATA Locus tag: LSL_0066 Name: scrA Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
	LSL_0066	scrA	Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
Position: -81 Score: 5.9 Sequence: TATGTTATACGATTGACAGT Locus tag: LSL_0065 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) Locus tag: LSL_0064 Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
	LSL_0065	scrB	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
	LSL_0064	scrR	Sucrose utilization transcriptional regulator ScrR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD