Regulon of ScrR in Lactobacillus acidophilus NCFM

Properties
Regulator type:	Transcription factor
TF locus tag:	LBA0399
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -168 Score: 6.4 Sequence: TATGTCAATCGTTTGACACA Position: -80 Score: 6.2 Sequence: TATGATAAACGTTTGACACA Locus tag: LBA0400 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) Locus tag: LBA0399 Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
	LBA0400	scrB	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
	LBA0399	scrR	Sucrose utilization transcriptional regulator ScrR, LacI family
Position: -174 Score: 6.1 Sequence: TGTGTCAAACGTTTATCATA Position: -86 Score: 6.5 Sequence: TGTGTCAAACGATTGACATA Locus tag: LBA0401 Name: scrA Funciton: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
	LBA0401	scrA	Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD