Statistics of regulated genes

Genome	Genes	Operons
Chloroflexus aggregans DSM 9485	6	2
Chloroflexus sp. Y-400-fl	6	2
Roseiflexus castenholzii DSM 13941	6	2
Herpetosiphon aurantiacus ATCC 23779	6	2
Roseiflexus sp. RS-1	6	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes						Function
CRON 1.
hrcA	* Chloroflexus aggregans DSM 9485 Site: position = -55 score = 7.59523 sequence = TTAGCACTCTCGCCTCACGAGTGCTAA Gene: Cagg_2696: Heat-inducible transcription repressor HrcA	* Chloroflexus sp. Y-400-fl Site: position = -55 score = 7.43587 sequence = TTAGCACTCTCACCTCACGAGTGCTAA Gene: Chy400_2238: Heat-inducible transcription repressor HrcA	* Roseiflexus castenholzii DSM 13941 Site: position = -102 score = 7.22691 sequence = CTAGCACTCACCGGTCGAGAGTGCTAA Gene: Rcas_4390: Heat-inducible transcription repressor HrcA	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -40 score = 7.325 sequence = TTAGCACTCCTCGGCCAAGAGTGCTAA Gene: Haur_0438: Heat-inducible transcription repressor HrcA	* Roseiflexus sp. RS-1 Site: position = -190 score = 7.07536 sequence = CTAGCACTCAATAGTCGAGAGTGCTAA Gene: RoseRS_3462: Heat-inducible transcription repressor HrcA	Heat-inducible transcription repressor HrcA
grpE	Chloroflexus aggregans DSM 9485 Gene: Cagg_2695: Heat shock protein GrpE	Chloroflexus sp. Y-400-fl Gene: Chy400_2237: Heat shock protein GrpE	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4391: Heat shock protein GrpE	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0439: Heat shock protein GrpE	Roseiflexus sp. RS-1 Gene: RoseRS_3461: Heat shock protein GrpE	Heat shock protein GrpE
dnaK	Chloroflexus aggregans DSM 9485 Gene: Cagg_2694: Chaperone protein DnaK	Chloroflexus sp. Y-400-fl Gene: Chy400_2236: Chaperone protein DnaK	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4392: Chaperone protein DnaK	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0440: Chaperone protein DnaK	Roseiflexus sp. RS-1 Gene: RoseRS_3460: Chaperone protein DnaK	Chaperone protein DnaK
dnaJ	Chloroflexus aggregans DSM 9485 Gene: Cagg_2693: Chaperone protein DnaJ	Chloroflexus sp. Y-400-fl Gene: Chy400_2235: Chaperone protein DnaJ	Roseiflexus castenholzii DSM 13941 Gene: Rcas_4393: Chaperone protein DnaJ	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_0441: Chaperone protein DnaJ	Roseiflexus sp. RS-1 Gene: RoseRS_3459: Chaperone protein DnaJ	Chaperone protein DnaJ
CRON 2.
groES	* Chloroflexus aggregans DSM 9485 Site: position = -81 score = 7.56762 sequence = TTAGCACTCTTGAGTTAACAGTGCTAA Site: position = -154 score = 6.00135 sequence = TTAGCACTCAGTTTCGACGAGTGCTAA Gene: Cagg_0489: Heat shock protein 60 family co-chaperone GroES	* Chloroflexus sp. Y-400-fl Site: position = -83 score = 7.36886 sequence = TTAGCACTCTCGACGTGACAGTGCTAA Site: position = -156 score = 6.01522 sequence = CTAGCAATCTCTAACGTCGAGTGCTAA Gene: Chy400_2961: Heat shock protein 60 family co-chaperone GroES	* Roseiflexus castenholzii DSM 13941 Site: position = -72 score = 7.67377 sequence = TTAGCACTCTTTGGTCAAGAGTGCTAA Site: position = -145 score = 6.35457 sequence = CTGGCACTCTCATCTGGCGAGTGCTAA Gene: Rcas_1212: Heat shock protein 60 family co-chaperone GroES	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -54 score = 6.75625 sequence = TTAGCACTCATCACAGTAGATTGCTAA Site: position = -129 score = 7.17832 sequence = TTAGCACTCTCAACCCAAGAGTGATAA Site: position = -231 score = 6.15139 sequence = TTAGCACTCTCGCCACGATTTTGCTAA Gene: Haur_3678: Heat shock protein 60 family co-chaperone GroES	* Roseiflexus sp. RS-1 Site: position = -75 score = 7.75523 sequence = TTAGCACTCTTCCGTCGAGAGTGCTAA Site: position = -148 score = 6.41072 sequence = CTGGCACTCTTCCCTTTTGAGTGCTAA Gene: RoseRS_4130: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groEL	Chloroflexus aggregans DSM 9485 Gene: Cagg_0488: Heat shock protein 60 family chaperone GroEL	Chloroflexus sp. Y-400-fl Gene: Chy400_2960: Heat shock protein 60 family chaperone GroEL	Roseiflexus castenholzii DSM 13941 Gene: Rcas_1211: Heat shock protein 60 family chaperone GroEL	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_3679: Heat shock protein 60 family chaperone GroEL	Roseiflexus sp. RS-1 Gene: RoseRS_4131: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD