Regulog HrcA - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | 6 | 2 |
| Chloroflexus sp. Y-400-fl | 6 | 2 |
| Roseiflexus castenholzii DSM 13941 | 6 | 2 |
| Herpetosiphon aurantiacus ATCC 23779 | 6 | 2 |
| Roseiflexus sp. RS-1 | 6 | 2 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| hrcA |
*
Chloroflexus aggregans DSM 9485 Site: position = -55 score = 7.59523 sequence = TTAGCACTCTCGCCTCACGAGTGCTAA Gene: Cagg_2696: Heat-inducible transcription repressor HrcA |
*
Chloroflexus sp. Y-400-fl Site: position = -55 score = 7.43587 sequence = TTAGCACTCTCACCTCACGAGTGCTAA Gene: Chy400_2238: Heat-inducible transcription repressor HrcA |
*
Roseiflexus castenholzii DSM 13941 Site: position = -102 score = 7.22691 sequence = CTAGCACTCACCGGTCGAGAGTGCTAA Gene: Rcas_4390: Heat-inducible transcription repressor HrcA |
*
Herpetosiphon aurantiacus ATCC 23779 Site: position = -40 score = 7.325 sequence = TTAGCACTCCTCGGCCAAGAGTGCTAA Gene: Haur_0438: Heat-inducible transcription repressor HrcA |
*
Roseiflexus sp. RS-1 Site: position = -190 score = 7.07536 sequence = CTAGCACTCAATAGTCGAGAGTGCTAA Gene: RoseRS_3462: Heat-inducible transcription repressor HrcA |
Heat-inducible transcription repressor HrcA |
| grpE |
Gene: Cagg_2695: Heat shock protein GrpE |
Gene: Chy400_2237: Heat shock protein GrpE |
Gene: Rcas_4391: Heat shock protein GrpE |
Gene: Haur_0439: Heat shock protein GrpE |
Gene: RoseRS_3461: Heat shock protein GrpE |
Heat shock protein GrpE |
| dnaK |
Gene: Cagg_2694: Chaperone protein DnaK |
Gene: Chy400_2236: Chaperone protein DnaK |
Gene: Rcas_4392: Chaperone protein DnaK |
Gene: Haur_0440: Chaperone protein DnaK |
Gene: RoseRS_3460: Chaperone protein DnaK |
Chaperone protein DnaK |
| dnaJ |
Gene: Cagg_2693: Chaperone protein DnaJ |
Gene: Chy400_2235: Chaperone protein DnaJ |
Gene: Rcas_4393: Chaperone protein DnaJ |
Gene: Haur_0441: Chaperone protein DnaJ |
Gene: RoseRS_3459: Chaperone protein DnaJ |
Chaperone protein DnaJ |
| CRON 2. | ||||||
| groES |
*
Chloroflexus aggregans DSM 9485 Site: position = -81 score = 7.56762 sequence = TTAGCACTCTTGAGTTAACAGTGCTAA Site: position = -154 score = 6.00135 sequence = TTAGCACTCAGTTTCGACGAGTGCTAA Gene: Cagg_0489: Heat shock protein 60 family co-chaperone GroES |
*
Chloroflexus sp. Y-400-fl Site: position = -83 score = 7.36886 sequence = TTAGCACTCTCGACGTGACAGTGCTAA Site: position = -156 score = 6.01522 sequence = CTAGCAATCTCTAACGTCGAGTGCTAA Gene: Chy400_2961: Heat shock protein 60 family co-chaperone GroES |
*
Roseiflexus castenholzii DSM 13941 Site: position = -72 score = 7.67377 sequence = TTAGCACTCTTTGGTCAAGAGTGCTAA Site: position = -145 score = 6.35457 sequence = CTGGCACTCTCATCTGGCGAGTGCTAA Gene: Rcas_1212: Heat shock protein 60 family co-chaperone GroES |
*
Herpetosiphon aurantiacus ATCC 23779 Site: position = -54 score = 6.75625 sequence = TTAGCACTCATCACAGTAGATTGCTAA Site: position = -129 score = 7.17832 sequence = TTAGCACTCTCAACCCAAGAGTGATAA Site: position = -231 score = 6.15139 sequence = TTAGCACTCTCGCCACGATTTTGCTAA Gene: Haur_3678: Heat shock protein 60 family co-chaperone GroES |
*
Roseiflexus sp. RS-1 Site: position = -75 score = 7.75523 sequence = TTAGCACTCTTCCGTCGAGAGTGCTAA Site: position = -148 score = 6.41072 sequence = CTGGCACTCTTCCCTTTTGAGTGCTAA Gene: RoseRS_4130: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groEL |
Gene: Cagg_0488: Heat shock protein 60 family chaperone GroEL |
Gene: Chy400_2960: Heat shock protein 60 family chaperone GroEL |
Gene: Rcas_1211: Heat shock protein 60 family chaperone GroEL |
Gene: Haur_3679: Heat shock protein 60 family chaperone GroEL |
Gene: RoseRS_4131: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |