Regulon of HrcA in Chloroflexus sp. Y-400-fl

Properties
Regulator type:	Transcription factor
TF locus tag:	Chy400_2238
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Chloroflexia
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 7.4 Sequence: TTAGCACTCTCACCTCACGAGTGCTAA Locus tag: Chy400_2238 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: Chy400_2237 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Chy400_2236 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Chy400_2235 Name: dnaJ Funciton: Chaperone protein DnaJ
	Chy400_2238	hrcA	Heat-inducible transcription repressor HrcA
	Chy400_2237	grpE	Heat shock protein GrpE
	Chy400_2236	dnaK	Chaperone protein DnaK
	Chy400_2235	dnaJ	Chaperone protein DnaJ
Position: -156 Score: 6 Sequence: CTAGCAATCTCTAACGTCGAGTGCTAA Position: -83 Score: 7.4 Sequence: TTAGCACTCTCGACGTGACAGTGCTAA Locus tag: Chy400_2961 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Chy400_2960 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	Chy400_2961	groES	Heat shock protein 60 family co-chaperone GroES
	Chy400_2960	groEL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD