Regulon of HrcA in Roseiflexus castenholzii DSM 13941

Properties
Regulator type:	Transcription factor
TF locus tag:	Rcas_4390
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Chloroflexia
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -145 Score: 6.4 Sequence: CTGGCACTCTCATCTGGCGAGTGCTAA Position: -72 Score: 7.7 Sequence: TTAGCACTCTTTGGTCAAGAGTGCTAA Locus tag: Rcas_1212 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Rcas_1211 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	Rcas_1212	groES	Heat shock protein 60 family co-chaperone GroES
	Rcas_1211	groEL	Heat shock protein 60 family chaperone GroEL
Position: -102 Score: 7.2 Sequence: CTAGCACTCACCGGTCGAGAGTGCTAA Locus tag: Rcas_4390 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: Rcas_4391 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Rcas_4392 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Rcas_4393 Name: dnaJ Funciton: Chaperone protein DnaJ
	Rcas_4390	hrcA	Heat-inducible transcription repressor HrcA
	Rcas_4391	grpE	Heat shock protein GrpE
	Rcas_4392	dnaK	Chaperone protein DnaK
	Rcas_4393	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD