Regulog Dbac_0104 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | |
| Biological process: | Metabolite transport |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - TetR
- By pathway - Metabolite transport
| Genome | Genes | Operons |
|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||
| Desulfomicrobium baculatum DSM 4028 | 4 | 2 |
| Desulfovibrio desulfuricans G20 | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio magneticus RS-1 | 5 | 2 |
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | 4 | 1 |
| Desulfovibrio vulgaris Hildenborough | ||
| Desulfovibrio vulgaris str. Miyazaki F | ||
| Lawsonia intracellularis PHE/MN1-00 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| DMR_28390 |
|
|
|
|
*
Desulfovibrio magneticus RS-1 Site: position = -26 score = 5.3006 sequence = TTGTGAACCGGTGTTAACTT Gene: DMR_28390: TetR family transcriptional regulator |
|
|
|
|
|
TetR family transcriptional regulator |
| CRON 2. | |||||||||||
| Dbac_0104 |
|
*
Desulfomicrobium baculatum DSM 4028 Site: position = -28 score = 5.87366 sequence = AAGTGAACGATCGTTAACTA Gene: Dbac_0104: transcriptional regulator, TetR family |
|
|
|
|
|
|
|
|
transcriptional regulator, TetR family |
| CRON 3. | |||||||||||
| DMR_28400 |
|
|
|
|
*
Desulfovibrio magneticus RS-1 Site: position = 32 score = 5.68759 sequence = AAGTGAACACGCGTTAACGC Gene: DMR_28400: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| acrA |
|
|
|
Gene: Ddes_0307: efflux transporter, RND family, MFP subunit |
Gene: DMR_28410: efflux transporter, RND family, MFP subunit |
Gene: DESPIG_02842: efflux transporter, RND family, MFP subunit |
|
Gene: DVU0060: efflux transporter, RND family, MFP subunit |
Gene: DvMF_2164: efflux transporter, RND family, MFP subunit |
Gene: LI0993: efflux transporter, RND family, MFP subunit |
efflux transporter, RND family, MFP subunit |
| acrB |
|
|
|
Gene: Ddes_0308: RND efflux system, inner membrane transporter CmeB |
Gene: DMR_28420: RND efflux system, inner membrane transporter CmeB |
Gene: DESPIG_02843: RND efflux system, inner membrane transporter CmeB |
|
Gene: DVU0061: RND efflux system, inner membrane transporter CmeB |
Gene: DvMF_2163: RND efflux system, inner membrane transporter CmeB |
Gene: LI0994: RND efflux system, inner membrane transporter CmeB |
RND efflux system, inner membrane transporter CmeB |
| DMR_28430 |
|
|
|
|
Gene: DMR_28430: Transcriptional regulator, MarR family |
|
|
|
Gene: DvMF_2161: Transcriptional regulator, MarR family |
|
Transcriptional regulator, MarR family |
| CRON 4. | |||||||||||
| acrA |
|
*
Desulfomicrobium baculatum DSM 4028 Site: position = -54 score = 6.09597 sequence = AAGTGAACACTTGTTCACAT Gene: Dbac_0103: efflux transporter, RND family, MFP subunit |
|
|
|
|
|
Gene: DVU2817: efflux transporter, RND family, MFP subunit |
|
|
efflux transporter, RND family, MFP subunit |
| DVU2816 |
|
Gene: Dbac_0102: RND efflux system, inner membrane transporter CmeB |
|
|
|
|
|
Gene: DVU2816: RND efflux system, inner membrane transporter CmeB |
|
|
RND efflux system, inner membrane transporter CmeB |
| Dbac_0101 |
|
Gene: Dbac_0101: RND efflux system, outer membrane lipoprotein, NodT family |
|
|
|
|
|
Gene: DVU2815: RND efflux system, outer membrane lipoprotein, NodT family |
|
|
RND efflux system, outer membrane lipoprotein, NodT family |
| CRON 5. | |||||||||||
| Desal_2340 |
|
|
|
|
|
|
*
Desulfovibrio salexigens DSM 2638 Site: position = -42 score = 5.32107 sequence = AAGTTAAAGTGAATTCACAT Site: position = -36 score = 5.54038 sequence = AAGTGAATTCACATTCACAT Gene: Desal_2340: transcriptional regulator, TetR family |
|
|
|
transcriptional regulator, TetR family |
| Desal_2341 |
|
|
Gene: Dde_0700: Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG |
Gene: Ddes_1342: Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG |
Gene: DMR_22940: Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG |
|
Gene: Desal_2341: Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG |
|
|
|
Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG |
| Desal_2342 |
|
|
Gene: Dde_0699: ABC transporter ATP-binding protein |
Gene: Ddes_1341: ABC transporter ATP-binding protein |
Gene: DMR_22930: ABC transporter ATP-binding protein |
|
Gene: Desal_2342: ABC transporter ATP-binding protein |
|
|
|
ABC transporter ATP-binding protein |
| Desal_2343 |
|
|
Gene: Dde_0698: ABC-type multidrug transport system, permease component |
Gene: Ddes_1340: ABC-type multidrug transport system, permease component |
Gene: DMR_22920: ABC-type multidrug transport system, permease component |
|
Gene: Desal_2343: ABC-type multidrug transport system, permease component |
|
|
|
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |