Regulon of Dbac_0104 in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_2340
Regulator family:	TetR
Regulation mode:
Biological process:	Metabolite transport
Effector:
Regulog:	Dbac_0104 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TetR
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 5.3 Sequence: AAGTTAAAGTGAATTCACAT Position: -36 Score: 5.5 Sequence: AAGTGAATTCACATTCACAT Locus tag: Desal_2340 Name: null Funciton: transcriptional regulator, TetR family Locus tag: Desal_2341 Name: null Funciton: Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG Locus tag: Desal_2342 Name: null Funciton: ABC transporter ATP-binding protein Locus tag: Desal_2343 Name: null Funciton: ABC-type multidrug transport system, permease component
	Desal_2340		transcriptional regulator, TetR family
	Desal_2341		Predicted membrane fusion protein (MFP) component of efflux pump, membrane anchor protein YbhG
	Desal_2342		ABC transporter ATP-binding protein
	Desal_2343		ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD