Regulon of Dbac_0104 in Desulfomicrobium baculatum DSM 4028

Properties
Regulator type:	Transcription factor
TF locus tag:	Dbac_0104
Regulator family:	TetR
Regulation mode:
Biological process:	Metabolite transport
Effector:
Regulog:	Dbac_0104 - Desulfovibrionales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TetR
By pathway - Metabolite transport

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6.1 Sequence: AAGTGAACACTTGTTCACAT Locus tag: Dbac_0103 Name: acrA Funciton: efflux transporter, RND family, MFP subunit Locus tag: Dbac_0102 Name: null Funciton: RND efflux system, inner membrane transporter CmeB Locus tag: Dbac_0101 Name: null Funciton: RND efflux system, outer membrane lipoprotein, NodT family
	Dbac_0103	acrA	efflux transporter, RND family, MFP subunit
	Dbac_0102		RND efflux system, inner membrane transporter CmeB
	Dbac_0101		RND efflux system, outer membrane lipoprotein, NodT family
Position: -28 Score: 5.9 Sequence: AAGTGAACGATCGTTAACTA Locus tag: Dbac_0104 Name: null Funciton: transcriptional regulator, TetR family
	Dbac_0104		transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD