Regulog PuuR - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | XRE |
| Regulation mode: | |
| Biological process: | Spermidine biosynthesis |
| Effector: | Putrescine |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - XRE
- By effector - Putrescine
- By pathway - Spermidine biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Fervidobacterium nodosum Rt17-B1 | 3 | 1 |
| Petrotoga mobilis SJ95 | ||
| Thermosipho africanus TCF52B | 7 | 1 |
| Thermosipho melanesiensis BI429 | 7 | 1 |
| Thermotoga lettingae TMO | 3 | 1 |
| Thermotoga maritima MSB8 | 3 | 1 |
| Thermotoga naphthophila RKU-10 | 3 | 1 |
| Thermotoga neapolitana DSM 4359 | 3 | 1 |
| Thermotoga petrophila RKU-1 | 3 | 1 |
| Thermotoga sp. RQ2 | 3 | 1 |
| Thermotogales bacterium TBF 19.5.1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| puuR |
Gene: Fnod_1325: Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
Gene: Pmob_1419: Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
*
Thermosipho africanus TCF52B Site: position = -59 score = 4.49399 sequence = ATGTTCTGTATCATAGACAT Site: position = -36 score = 5.6224 sequence = TTGTTCAGTATTATAGACAT Gene: THA_1405: Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
*
Thermosipho melanesiensis BI429 Site: position = -32 score = 5.48714 sequence = TTGTTTAGTATTATAGACAT Gene: Tmel_0572: Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
*
Thermotoga lettingae TMO Site: position = -220 score = 5.1977 sequence = TTGTTGAGGATAATTGACAA Site: position = -62 score = 5.47712 sequence = GTGATCAATATACTGGACAA Gene: Tlet_0752: Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
*
Thermotoga maritima MSB8 Site: position = -58 score = 4.76475 sequence = ATGTCTGTGATACTGAACAA Site: position = -36 score = 6.8092 sequence = TTGTCAACTATAGTGGACAA Gene: TM0656: Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
*
Thermotoga naphthophila RKU-10 Site: position = -58 score = 4.76475 sequence = ATGTCTGTGATACTGAACAA Site: position = -36 score = 6.8092 sequence = TTGTCAACTATAGTGGACAA Gene: Tnap_0452: Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
*
Thermotoga neapolitana DSM 4359 Site: position = -22 score = 4.76475 sequence = ATGTCTGTGATACTGAACAA Site: position = 0 score = 6.42085 sequence = TTGTCAACTATAGTGGTCAA Gene: CTN_0001: Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
*
Thermotoga petrophila RKU-1 Site: position = -22 score = 4.76475 sequence = ATGTCTGTGATACTGAACAA Site: position = 0 score = 6.8092 sequence = TTGTCAACTATAGTGGACAA Gene: Tpet_0275: Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
*
Thermotoga sp. RQ2 Site: position = -58 score = 4.76475 sequence = ATGTCTGTGATACTGAACAA Site: position = -36 score = 6.8092 sequence = TTGTCAACTATAGTGGACAA Gene: TRQ2_0273: Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
|
Predicted transcriptional regulator of spermidine biosynthesis, Xre family |
| speD |
*
Fervidobacterium nodosum Rt17-B1 Site: position = -134 score = 4.90103 sequence = TTGTTCACTTAAGTAAACAT Gene: Fnod_1327: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
Gene: Pmob_1418: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
Gene: THA_1404: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
Gene: Tmel_0571: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
Gene: Tlet_0753: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
Gene: TM0655: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
Gene: Tnap_0451: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
Gene: CTN_0002: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
Gene: Tpet_0276: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
Gene: TRQ2_0274: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
Gene: Kole_0270: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B |
| speE |
Gene: Fnod_1326: Spermidine synthase (EC 2.5.1.16) |
Gene: Pmob_1417: Spermidine synthase (EC 2.5.1.16) |
Gene: THA_1403: Spermidine synthase (EC 2.5.1.16) |
Gene: Tmel_0570: Spermidine synthase (EC 2.5.1.16) |
Gene: Tlet_0754: Spermidine synthase (EC 2.5.1.16) |
Gene: TM0654: Spermidine synthase (EC 2.5.1.16) |
Gene: Tnap_0450: Spermidine synthase (EC 2.5.1.16) |
Gene: CTN_0003: Spermidine synthase (EC 2.5.1.16) |
Gene: Tpet_0277: Spermidine synthase (EC 2.5.1.16) |
Gene: TRQ2_0275: Spermidine synthase (EC 2.5.1.16) |
Gene: Kole_0271: Spermidine synthase (EC 2.5.1.16) |
Spermidine synthase (EC 2.5.1.16) |
| potF |
Gene: Fnod_1364: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) |
|
Gene: THA_1402: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) |
Gene: Tmel_0569: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) |
|
Gene: TM1375: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) |
Gene: Tnap_1428: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) |
Gene: CTN_1216: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) |
Gene: Tpet_1408: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) |
Gene: TRQ2_1454: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) |
|
Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) |
| potA |
Gene: Fnod_0370: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) |
|
Gene: THA_1401: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) |
Gene: Tmel_0568: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) |
|
Gene: TM1376: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) |
Gene: Tnap_1427: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) |
Gene: CTN_1215: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) |
Gene: Tpet_1407: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) |
Gene: TRQ2_1453: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) |
|
Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) |
| potB |
Gene: Fnod_0371: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) |
|
Gene: THA_1400: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) |
Gene: Tmel_0567: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) |
|
Gene: TM1377: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) |
Gene: Tnap_1426: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) |
Gene: CTN_1214: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) |
Gene: Tpet_1406: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) |
Gene: TRQ2_1452: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) |
|
Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) |
| potC |
Gene: Fnod_0372: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
|
Gene: THA_1399: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
Gene: Tmel_0566: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
|
Gene: TM1378: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
Gene: Tnap_1425: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
Gene: CTN_1213: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
Gene: Tpet_1405: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
Gene: TRQ2_1451: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
|
Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |