Regulon of PuuR in Thermotoga lettingae TMO

Properties
Regulator type:	Transcription factor
TF locus tag:	Tlet_0752
Regulator family:	XRE
Regulation mode:
Biological process:	Spermidine biosynthesis
Effector:	Putrescine
Regulog:	PuuR - Thermotogales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - XRE
By effector - Putrescine
By pathway - Spermidine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -220 Score: 5.2 Sequence: TTGTTGAGGATAATTGACAA Position: -62 Score: 5.5 Sequence: GTGATCAATATACTGGACAA Locus tag: Tlet_0752 Name: puuR Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family Locus tag: Tlet_0753 Name: speD Funciton: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B Locus tag: Tlet_0754 Name: speE Funciton: Spermidine synthase (EC 2.5.1.16)
	Tlet_0752	puuR	Predicted transcriptional regulator of spermidine biosynthesis, Xre family
	Tlet_0753	speD	S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
	Tlet_0754	speE	Spermidine synthase (EC 2.5.1.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD