Regulon of PuuR in Thermosipho africanus TCF52B

Properties
Regulator type:	Transcription factor
TF locus tag:	THA_1405
Regulator family:	XRE
Regulation mode:
Biological process:	Spermidine biosynthesis
Effector:	Putrescine
Regulog:	PuuR - Thermotogales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - XRE
By effector - Putrescine
By pathway - Spermidine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 4.5 Sequence: ATGTTCTGTATCATAGACAT Position: -36 Score: 5.6 Sequence: TTGTTCAGTATTATAGACAT Locus tag: THA_1405 Name: puuR Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family Locus tag: THA_1404 Name: speD Funciton: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B Locus tag: THA_1403 Name: speE Funciton: Spermidine synthase (EC 2.5.1.16) Locus tag: THA_1402 Name: potF Funciton: Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2) Locus tag: THA_1401 Name: potA Funciton: Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1) Locus tag: THA_1400 Name: potB Funciton: Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1) Locus tag: THA_1399 Name: potC Funciton: Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)
	THA_1405	puuR	Predicted transcriptional regulator of spermidine biosynthesis, Xre family
	THA_1404	speD	S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
	THA_1403	speE	Spermidine synthase (EC 2.5.1.16)
	THA_1402	potF	Spermidine Putrescine ABC transporter putrescine-binding protein PotF (TC 3.A.1.11.2)
	THA_1401	potA	Spermidine Putrescine transport ATP-binding protein PotA (TC 3.A.1.11.1)
	THA_1400	potB	Spermidine Putrescine ABC transporter permease component PotB (TC 3.A.1.11.1)
	THA_1399	potC	Spermidine Putrescine ABC transporter permease component potC (TC_3.A.1.11.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD