Regulon of PuuR in Thermotoga neapolitana DSM 4359

Properties
Regulator type:	Transcription factor
TF locus tag:	CTN_0001
Regulator family:	XRE
Regulation mode:
Biological process:	Spermidine biosynthesis
Effector:	Putrescine
Regulog:	PuuR - Thermotogales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - XRE
By effector - Putrescine
By pathway - Spermidine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -22 Score: 4.8 Sequence: ATGTCTGTGATACTGAACAA Position: 0 Score: 6.4 Sequence: TTGTCAACTATAGTGGTCAA Locus tag: CTN_0001 Name: puuR Funciton: Predicted transcriptional regulator of spermidine biosynthesis, Xre family Locus tag: CTN_0002 Name: speD Funciton: S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B Locus tag: CTN_0003 Name: speE Funciton: Spermidine synthase (EC 2.5.1.16)
	CTN_0001	puuR	Predicted transcriptional regulator of spermidine biosynthesis, Xre family
	CTN_0002	speD	S-adenosylmethionine decarboxylase proenzyme (EC 4.1.1.50), prokaryotic class 1B
	CTN_0003	speE	Spermidine synthase (EC 2.5.1.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD