Regulog ModE2 - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Rhodobacterales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222	3	1
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654	3	1
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM
Roseovarius sp. 217	3	1
Sulfitobacter sp. EE-36
Silicibacter TM1040
Silicibacter pomeroyi DSS-3	3	1
Roseobacter sp. MED193
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
modA	Rhodobacter sphaeroides 2.4.1	* Paracoccus denitrificans PD1222 Site: position = -37 score = 5.21367 sequence = GTTATGTCCGTTTGAACATAAT Gene: Pden_2665: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Jannaschia sp. CCS1	* Rhodobacterales bacterium HTCC2654 Site: position = -11 score = 5.64415 sequence = GATATGTTTCAGTGAACATATC Gene: RB2654_14140: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	* Roseovarius sp. 217 Site: position = -41 score = 5.64415 sequence = GATATGTTTCAGTGAACATATC Site: position = -88 score = 5.53801 sequence = GATGTATCTGAGTGAACATAAC Gene: ROS217_12636: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Sulfitobacter sp. EE-36	Silicibacter TM1040	* Silicibacter pomeroyi DSS-3 Site: position = -24 score = 4.96038 sequence = GATATTTCCGCCCAGACATATC Gene: SPO0699: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_2666: Molybdate ABC transporter, permease protein	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654 Gene: RB2654_14135: Molybdate ABC transporter, permease protein	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_12641: Molybdate ABC transporter, permease protein	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3 Gene: SPO0698: Molybdate ABC transporter, permease protein	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Molybdate ABC transporter, permease protein
modC	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222 Gene: Pden_2667: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654 Gene: RB2654_14125: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217 Gene: ROS217_12646: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3 Gene: SPO0697: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ModE2 - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --