Regulog ModE2 - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Rhodobacterales
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | ||
| Paracoccus denitrificans PD1222 | 3 | 1 |
| Jannaschia sp. CCS1 | ||
| Rhodobacterales bacterium HTCC2654 | 3 | 1 |
| Oceanicola granulosus HTCC2516 | ||
| Loktanella vestfoldensis SKA53 | ||
| Oceanicola batsensis HTCC2597 | ||
| Roseovarius nubinhibens ISM | ||
| Roseovarius sp. 217 | 3 | 1 |
| Sulfitobacter sp. EE-36 | ||
| Silicibacter TM1040 | ||
| Silicibacter pomeroyi DSS-3 | 3 | 1 |
| Roseobacter sp. MED193 | ||
| Hyphomonas neptunium ATCC 15444 | ||
| Oceanicaulis alexandrii HTCC2633 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| modA |
|
*
Paracoccus denitrificans PD1222 Site: position = -37 score = 5.21367 sequence = GTTATGTCCGTTTGAACATAAT Gene: Pden_2665: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
*
Rhodobacterales bacterium HTCC2654 Site: position = -11 score = 5.64415 sequence = GATATGTTTCAGTGAACATATC Gene: RB2654_14140: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
|
|
|
*
Roseovarius sp. 217 Site: position = -41 score = 5.64415 sequence = GATATGTTTCAGTGAACATATC Site: position = -88 score = 5.53801 sequence = GATGTATCTGAGTGAACATAAC Gene: ROS217_12636: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
|
*
Silicibacter pomeroyi DSS-3 Site: position = -24 score = 4.96038 sequence = GATATTTCCGCCCAGACATATC Gene: SPO0699: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
|
|
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
| modB |
|
Gene: Pden_2666: Molybdate ABC transporter, permease protein |
|
Gene: RB2654_14135: Molybdate ABC transporter, permease protein |
|
|
|
|
Gene: ROS217_12641: Molybdate ABC transporter, permease protein |
|
|
Gene: SPO0698: Molybdate ABC transporter, permease protein |
|
|
|
Molybdate ABC transporter, permease protein |
| modC |
|
Gene: Pden_2667: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
|
Gene: RB2654_14125: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
|
|
|
|
Gene: ROS217_12646: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
|
|
Gene: SPO0697: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
|
|
|
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |