Regulon of ModE2 in Silicibacter pomeroyi DSS-3

Properties
Regulator type:	Transcription factor
TF locus tag:	SPO0700
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE2 - Rhodobacterales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Rhodobacterales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -24 Score: 5 Sequence: GATATTTCCGCCCAGACATATC Locus tag: SPO0699 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: SPO0698 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: SPO0697 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	SPO0699	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	SPO0698	modB	Molybdate ABC transporter, permease protein
	SPO0697	modC	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD