Regulon of ModE2 in Paracoccus denitrificans PD1222

Properties
Regulator type:	Transcription factor
TF locus tag:	Pden_2664
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE2 - Rhodobacterales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Rhodobacterales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 5.2 Sequence: GTTATGTCCGTTTGAACATAAT Locus tag: Pden_2665 Name: null Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Pden_2666 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: Pden_2667 Name: null Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Pden_2665		Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Pden_2666	modB	Molybdate ABC transporter, permease protein
	Pden_2667		Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD