Regulon of ModE2 in Paracoccus denitrificans PD1222
Regulator type: | Transcription factor |
TF locus tag: | Pden_2664 |
Regulator family: | ModE |
Regulation mode: | repressor (activator) |
Biological process: | Molybdenum homeostasis |
Effector: | Molybdate |
Regulog: | ModE2 - Rhodobacterales |
Statistics of regulated genes: | |
- Genes | 3 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Rhodobacterales
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
Locus Tag | Name | Function | |
---|---|---|---|
Position: -37
Score: 5.2 Sequence: GTTATGTCCGTTTGAACATAAT
Locus tag: Pden_2665
Name: null Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Pden_2666
Name: modB Funciton: Molybdate ABC transporter, permease protein
Locus tag: Pden_2667
Name: null Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
|||
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
|
|||
modB
|
Molybdate ABC transporter, permease protein
|
||
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |