Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulon of ModE2 in Rhodobacterales bacterium HTCC2654

Properties
Regulator type: Transcription factor
TF locus tag: RB2654_14145
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdenum homeostasis
Effector: Molybdate
Regulog: ModE2 - Rhodobacterales
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -11
Score: 5.6
Sequence: GATATGTTTCAGTGAACATATC
Locus tag: RB2654_14140
Name: null
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: RB2654_14135
Name: modB
Funciton: Molybdate ABC transporter, permease protein
Locus tag: RB2654_14125
Name: null
Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
Molybdate ABC transporter, permease protein
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD