Regulon of ModE2 in Rhodobacterales bacterium HTCC2654

Properties
Regulator type:	Transcription factor
TF locus tag:	RB2654_14145
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE2 - Rhodobacterales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Rhodobacterales
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -11 Score: 5.6 Sequence: GATATGTTTCAGTGAACATATC Locus tag: RB2654_14140 Name: null Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: RB2654_14135 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: RB2654_14125 Name: null Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	RB2654_14140		Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	RB2654_14135	modB	Molybdate ABC transporter, permease protein
	RB2654_14125		Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD