Statistics of regulated genes

Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1	3	1
Acidovorax sp. JS42	4	2
Comamonas testosteroni KF-1	4	2
Delftia acidovorans SPH-1	4	2
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236	4	2
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2	3	1
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes												Function
CRON 1.
modA	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -13 score = 7.34801 sequence = CGCTATTCAGTCGATGAATAGCG Gene: Aave_2028: Molybdate ABC transporter, substrate-binding protein	* Acidovorax sp. JS42 Site: position = -34 score = 7.00141 sequence = CGCTATTCATCAATGGAATAGCG Gene: Ajs_3124: Molybdate ABC transporter, substrate-binding protein	* Comamonas testosteroni KF-1 Site: position = -13 score = 7.31235 sequence = CGCTATTCAAACAATGAATAGCG Gene: CtesDRAFT_2992: Molybdate ABC transporter, substrate-binding protein	* Delftia acidovorans SPH-1 Site: position = 26 score = 6.75665 sequence = CGCTATTCACCAACGGAATAGCG Gene: Daci_1520: Molybdate ABC transporter, substrate-binding protein	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2037: Molybdate ABC transporter, substrate-binding protein	Polaromonas sp. JS666 Gene: Bpro_0161: Molybdate ABC transporter, substrate-binding protein	* Rhodoferax ferrireducens DSM 15236 Site: position = -90 score = 6.45766 sequence = CGCTATTCCTAATTAGAATAGCG Gene: Rfer_2858: Molybdate ABC transporter, substrate-binding protein	Variovorax paradoxus S110 Gene: Vapar_4069: Molybdate ABC transporter, substrate-binding protein	* Verminephrobacter eiseniae EF01-2 Site: position = -44 score = 7.37256 sequence = CGCTATTCCTTCAATGAATAGCG Gene: Veis_2888: Molybdate ABC transporter, substrate-binding protein	Methylibium petroleiphilum PM1 Gene: Mpe_A3713: Molybdate ABC transporter, substrate-binding protein	Leptothrix cholodnii SP-6 Gene: Lcho_1356: Molybdate ABC transporter, substrate-binding protein	Molybdate ABC transporter, substrate-binding protein
modB	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2027: Molybdate ABC transporter, permease protein	Acidovorax sp. JS42 Gene: Ajs_3125: Molybdate ABC transporter, permease protein	Comamonas testosteroni KF-1 Gene: CtesDRAFT_2993: Molybdate ABC transporter, permease protein	Delftia acidovorans SPH-1 Gene: Daci_1519: Molybdate ABC transporter, permease protein	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2040: Molybdate ABC transporter, permease protein	Polaromonas sp. JS666 Gene: Bpro_0162: Molybdate ABC transporter, permease protein	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2859: Molybdate ABC transporter, permease protein	Variovorax paradoxus S110 Gene: Vapar_4070: Molybdate ABC transporter, permease protein	Verminephrobacter eiseniae EF01-2 Gene: Veis_2887: Molybdate ABC transporter, permease protein	Methylibium petroleiphilum PM1 Gene: Mpe_A3714: Molybdate ABC transporter, permease protein	Leptothrix cholodnii SP-6 Gene: Lcho_1357: Molybdate ABC transporter, permease protein	Molybdate ABC transporter, permease protein
modC	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2026: Molybdate ABC transporter, ATP-binding protein	Acidovorax sp. JS42 Gene: Ajs_3126: Molybdate ABC transporter, ATP-binding protein	Comamonas testosteroni KF-1 Gene: CtesDRAFT_2994: Molybdate ABC transporter, ATP-binding protein	Delftia acidovorans SPH-1 Gene: Daci_1518: Molybdate ABC transporter, ATP-binding protein	Polaromonas naphthalenivorans CJ2 Gene: Pnap_2041: Molybdate ABC transporter, ATP-binding protein	Polaromonas sp. JS666 Gene: Bpro_0163: Molybdate ABC transporter, ATP-binding protein	Rhodoferax ferrireducens DSM 15236 Gene: Rfer_2860: Molybdate ABC transporter, ATP-binding protein	Variovorax paradoxus S110 Gene: Vapar_4068: Molybdate ABC transporter, ATP-binding protein	Verminephrobacter eiseniae EF01-2 Gene: Veis_2886: Molybdate ABC transporter, ATP-binding protein	Methylibium petroleiphilum PM1 Gene: Mpe_A3715: Molybdate ABC transporter, ATP-binding protein	Leptothrix cholodnii SP-6 Gene: Lcho_1358: Molybdate ABC transporter, ATP-binding protein	Molybdate ABC transporter, ATP-binding protein
modE	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2030: Molybdate-responsive transcriptional regulator ModE	* Acidovorax sp. JS42 Site: position = -13 score = 7.32779 sequence = CGCTATTCCATTGATGAATAGCG Gene: Ajs_3123: Molybdate-responsive transcriptional regulator ModE	* Comamonas testosteroni KF-1 Site: position = -89 score = 7.05487 sequence = CGCTATTCATTGTTTGAATAGCG Gene: CtesDRAFT_2991: Molybdate-responsive transcriptional regulator ModE	* Delftia acidovorans SPH-1 Site: position = -86 score = 7.03465 sequence = CGCTATTCCGTTGGTGAATAGCG Gene: Daci_1521: Molybdate-responsive transcriptional regulator ModE	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	* Rhodoferax ferrireducens DSM 15236 Site: position = -74 score = 6.86436 sequence = CGCTATTCTAATTAGGAATAGCG Gene: Rfer_2857: Molybdate-responsive transcriptional regulator ModE	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_4545: Molybdate-responsive transcriptional regulator ModE	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Molybdate-responsive transcriptional regulator ModE

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD