Regulog ModE - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - ModE
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 3 | 1 |
| Acidovorax sp. JS42 | 4 | 2 |
| Comamonas testosteroni KF-1 | 4 | 2 |
| Delftia acidovorans SPH-1 | 4 | 2 |
| Polaromonas naphthalenivorans CJ2 | ||
| Polaromonas sp. JS666 | ||
| Rhodoferax ferrireducens DSM 15236 | 4 | 2 |
| Variovorax paradoxus S110 | ||
| Verminephrobacter eiseniae EF01-2 | 3 | 1 |
| Methylibium petroleiphilum PM1 | ||
| Leptothrix cholodnii SP-6 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| modA |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -13 score = 7.34801 sequence = CGCTATTCAGTCGATGAATAGCG Gene: Aave_2028: Molybdate ABC transporter, substrate-binding protein |
*
Acidovorax sp. JS42 Site: position = -34 score = 7.00141 sequence = CGCTATTCATCAATGGAATAGCG Gene: Ajs_3124: Molybdate ABC transporter, substrate-binding protein |
*
Comamonas testosteroni KF-1 Site: position = -13 score = 7.31235 sequence = CGCTATTCAAACAATGAATAGCG Gene: CtesDRAFT_2992: Molybdate ABC transporter, substrate-binding protein |
*
Delftia acidovorans SPH-1 Site: position = 26 score = 6.75665 sequence = CGCTATTCACCAACGGAATAGCG Gene: Daci_1520: Molybdate ABC transporter, substrate-binding protein |
Gene: Pnap_2037: Molybdate ABC transporter, substrate-binding protein |
Gene: Bpro_0161: Molybdate ABC transporter, substrate-binding protein |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -90 score = 6.45766 sequence = CGCTATTCCTAATTAGAATAGCG Gene: Rfer_2858: Molybdate ABC transporter, substrate-binding protein |
Gene: Vapar_4069: Molybdate ABC transporter, substrate-binding protein |
*
Verminephrobacter eiseniae EF01-2 Site: position = -44 score = 7.37256 sequence = CGCTATTCCTTCAATGAATAGCG Gene: Veis_2888: Molybdate ABC transporter, substrate-binding protein |
Gene: Mpe_A3713: Molybdate ABC transporter, substrate-binding protein |
Gene: Lcho_1356: Molybdate ABC transporter, substrate-binding protein |
Molybdate ABC transporter, substrate-binding protein |
| modB |
Gene: Aave_2027: Molybdate ABC transporter, permease protein |
Gene: Ajs_3125: Molybdate ABC transporter, permease protein |
Gene: CtesDRAFT_2993: Molybdate ABC transporter, permease protein |
Gene: Daci_1519: Molybdate ABC transporter, permease protein |
Gene: Pnap_2040: Molybdate ABC transporter, permease protein |
Gene: Bpro_0162: Molybdate ABC transporter, permease protein |
Gene: Rfer_2859: Molybdate ABC transporter, permease protein |
Gene: Vapar_4070: Molybdate ABC transporter, permease protein |
Gene: Veis_2887: Molybdate ABC transporter, permease protein |
Gene: Mpe_A3714: Molybdate ABC transporter, permease protein |
Gene: Lcho_1357: Molybdate ABC transporter, permease protein |
Molybdate ABC transporter, permease protein |
| modC |
Gene: Aave_2026: Molybdate ABC transporter, ATP-binding protein |
Gene: Ajs_3126: Molybdate ABC transporter, ATP-binding protein |
Gene: CtesDRAFT_2994: Molybdate ABC transporter, ATP-binding protein |
Gene: Daci_1518: Molybdate ABC transporter, ATP-binding protein |
Gene: Pnap_2041: Molybdate ABC transporter, ATP-binding protein |
Gene: Bpro_0163: Molybdate ABC transporter, ATP-binding protein |
Gene: Rfer_2860: Molybdate ABC transporter, ATP-binding protein |
Gene: Vapar_4068: Molybdate ABC transporter, ATP-binding protein |
Gene: Veis_2886: Molybdate ABC transporter, ATP-binding protein |
Gene: Mpe_A3715: Molybdate ABC transporter, ATP-binding protein |
Gene: Lcho_1358: Molybdate ABC transporter, ATP-binding protein |
Molybdate ABC transporter, ATP-binding protein |
| modE |
Gene: Aave_2030: Molybdate-responsive transcriptional regulator ModE |
*
Acidovorax sp. JS42 Site: position = -13 score = 7.32779 sequence = CGCTATTCCATTGATGAATAGCG Gene: Ajs_3123: Molybdate-responsive transcriptional regulator ModE |
*
Comamonas testosteroni KF-1 Site: position = -89 score = 7.05487 sequence = CGCTATTCATTGTTTGAATAGCG Gene: CtesDRAFT_2991: Molybdate-responsive transcriptional regulator ModE |
*
Delftia acidovorans SPH-1 Site: position = -86 score = 7.03465 sequence = CGCTATTCCGTTGGTGAATAGCG Gene: Daci_1521: Molybdate-responsive transcriptional regulator ModE |
|
|
*
Rhodoferax ferrireducens DSM 15236 Site: position = -74 score = 6.86436 sequence = CGCTATTCTAATTAGGAATAGCG Gene: Rfer_2857: Molybdate-responsive transcriptional regulator ModE |
|
Gene: Veis_4545: Molybdate-responsive transcriptional regulator ModE |
|
|
Molybdate-responsive transcriptional regulator ModE |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |