Regulon of ModE in Comamonas testosteroni KF-1

Properties
Regulator type:	Transcription factor
TF locus tag:	CtesDRAFT_2991
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -13 Score: 7.3 Sequence: CGCTATTCAAACAATGAATAGCG Locus tag: CtesDRAFT_2992 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: CtesDRAFT_2993 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: CtesDRAFT_2994 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	CtesDRAFT_2992	modA	Molybdate ABC transporter, substrate-binding protein
	CtesDRAFT_2993	modB	Molybdate ABC transporter, permease protein
	CtesDRAFT_2994	modC	Molybdate ABC transporter, ATP-binding protein
Position: -89 Score: 7.1 Sequence: CGCTATTCATTGTTTGAATAGCG Locus tag: CtesDRAFT_2991 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	CtesDRAFT_2991	modE	Molybdate-responsive transcriptional regulator ModE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD